WO1999051270A1

WO1999051270A1 - A novel nitroreductase and therapeutic uses therefor

Info

Publication number: WO1999051270A1
Application number: PCT/US1999/007546
Authority: WO
Inventors: Avery Goodwin; Paul S. Hoffman
Original assignee: Dalhousie University
Priority date: 1998-04-06
Filing date: 1999-04-06
Publication date: 1999-10-14
Also published as: EP1069911A1; CA2325050A1

Abstract

In accordance with the present invention, the gene responsible for metronidazole sensitivity in H. pylori has been identified. Mutational inactivation of the gene, which encodes an oxygen-insensitive NADPH nitroreductase, referred to herein as rdxA (designated HP0954 in the entire genome sequence) (Tomb et al., 1997) is the cause of naturally acquired MtzR in H. pylori. In accordance with one embodiment of the present invention, there is provided a method of employing RdxA and related compounds, optionally in conjunction with targeting compounds, to convert nitroaromatic compounds to cytotoxins for use in selectively killing or inhibiting the growth of target cell populations. In accordance with another aspect of the present invention, there is provided a method of employing RdxA and related compounds in order to convert nitroaromatic compounds to cytotoxins for use in selecting against cells expressing rdxA.

Description

A NOVEL NTTROREPUCTASE AND THERAPEUTIC USES THEREFOR

RELATED APPLICATIONS

This application claims priority from United States Application Nos. 60/080,917, filed April 6, 1998, and 60/081,778, filed April 14, 1998, the entire contents of both of which are hereby incorporated by reference herein in their entirety.

FIELD OF INVENTION

The present invention relates to nitroreductases, nucleic acids encoding nitroreductases, microaerophilic bacteria from which such nitroreductases may be isolated, conjugates of targeting compounds and nitroreductases and methods of using same.

BACKGROUND

Metronidazole (Mtz) [l-(2-hydroxyethyl)-2-methyl-5-nitroimidazole] is a key component of combination therapies that are widely used against Helicobacter pylori (Malfertheiner et al, 1997), a microaerophilic, Gram-negative pathogen that is highly specific for the human gastric mucosa. H. pylori tends to establish chronic and often life-long infections that constitute a major cause of peptic ulcer disease and an important risk factor for gastric cancer, one of the most common malignancies worldwide (Correa, 1996). Most residents of developing countries are infected with H. pylori (Taylor and Parsonnel, 1995); this situation is ascribed to poor sanitation, which results in frequent exposure to the pathogen. In the U.S. and Western Europe, the prevalence of infection is generally lower, and is correlated with socioeconomic status and age: approximately half of older adults but less than one-tenth of young children in these industrialized societies are H. τy/or -infected (Taylor and Parsonnel, 1995; Dunn et al, 1997). R

Mtz resistance (Mtz ) is an important variable in the treatment of H. pylori infections, indeed its presence markedly reduces the efficiency of Mtz-containing treatment regimens (Chiba et al, 1992; Graham et al; 1992). The incidence of Mtz^R also varies geographically with half or more of H. pylori strains from developing countries and approximately 10-30% of strains from the US and Western Europe being Mtz (Dυim et L, 1997) Veldhuyzen van Zanten et al, 1997). The incidence of Mtz among H. pylori isolates generally parallels the level of Mtz usage in a particular society. Thus, it is parsimonious to imagine that many of the H. pylori strains currently resistant to Mtz reflect the frequent use of Mtz and related nitroimidazoles for treatment of anaerobic and protozoan infections, but in dosing c regimens that generally do not eliminate Mtz H. pylori from an infected person. (Grunberg and Titsworth, 1974; Hoff and Sticht-Groh, 1984; Edwards, 1993). Any inhibition of H. pylori growth during such periods of Mtz therapy would enrich or select for Mtz strains.

The basis for susceptibility of wild-type H. pylori to Mtz and the mechanisms of resistance have been of interest and concern since the early days of H. pylori research (see, for example, McNulty et al, 1985; Glupczynski and Burette, 1990). Well-studied model organisms such as Pseudomonas aeruginosa and Escherichia coli, which are aerobic or facultatively anaerobic, are Mtz , whereas many anaerobics and microaerophiles are susceptible to Mtz (Mtz ). Mtz is relatively rare in anaerobes (Rasmussen et al, 1997), and therefore, one might imagine that the high incidence of Mtz in microaerophiles is due to a mechanism of action that differs from that found in anaerobes. The available evidence from studies of protozoan and anaerobic bacterial species suggests that Mtz toxicity to H. pylori might depend on its reduction to the nitro anion radical and other compounds including hydroxylamine (Moreno et al, 1982; Lindmark and Muller, 1975; Kedderis et al, 1988). Hydroxylamine is particularly damaging to macromolecules such as DNA and proteins (Lindmark and Muller, 1976; Kedderis et al, 1988). Under aerobic or microaerobic conditions, molecular oxygen could convert reduced Mtz (i.e., the nitro anion radical) back to the parent compound by a process termed 'futile cycling', which essentially generates superoxide anions instead of hydroxylamine (Smith and Edwards, 1995). Because futile cycling has not been demonstrated experimentally (Smith and Edwards, 1995), reductions involving two and four electron transfers that favor hydroxylamine formation, such as would occur with ferredoxins and flavodoxins as electron donors, seemed very plausible, despite a lack of experimental evidence for direct enzymatic reduction of Mtz by H. pylori. Given this background, several possible mechanisms for Mtz in H. pylori merit consideration: decreased Mtz uptake or active efflux; deficiency in Mtz activation or modification; target modification or loss; and increased DNA repair or oxygen scavenging capabilities (Hoffman et al, 1996). Indeed, inactivation of recA, a gene needed for generalized DNA repair and recombination, greatly enhances Mtz susceptibility of wild-type H. pylori (Thompson and Blaser, 1995); and cloned recA gene from a Mtz strain seems to increase the already very high level of resistance that E. coli exhibits (Chang et al, 1997).

Thus a need exists for the identification of the gene(s) responsible for the Mtz and Mtz phenotypes in H. pylori, and characterization of proteins encoded by such gene(s).

BRIEF DESCRIPTION OF THE INVENTION

In accordance with the present invention, the gene responsible for metronidazole sensitivity in H. pylori has been identified. Mutational inactivation of the gene, which encodes an oxygen-insensitive NADPH nitroreductase, referred to herein as rdxA (designated HP0954 in the entire genome sequence) (Tomb et al, 1997), is the cause of naturally acquired Mtz m H. pylori. In accordance with another embodiment of the present invention, there is provided a method of employing RdxA and related compounds, optionally in conjunction with targeting compounds, to convert nitroaromatic compounds to cytotoxins for use in selectively killing or inhibiting the growth of target cell populations. In accordance with another aspect of the present invention, there is provided a method of employing RdxA and related compounds in order to convert nitroaromatic compounds to cytotoxins for use in selecting against cells expressing rdxA.

BRIEF DESCRIPTION OF THE FIGURES

Fig. 1. shows the nucleotide sequence and deduced amino acid sequence of rdxA of WT strain 500. The Shine-Dalgarno (SD) ribosome-binding site is underlined on the nucleotide sequence. The underlined amino acid sequence defines a highly conserved region among classic nitroreductase (CNR) proteins. Cysteine residues are highlighted in bold face and the Sphl sites used for insertion of the camR cassette are underlined and noted. * *H. pylori strains 439 and 1107 contain transition substitutions (TT for CC).

Fig. 2. indicates the location of amino acid substitutions in RdxA from

R/S matched Mtz strains and from clinical isolates. H. pylori strain 1107 was created by transforming DNA from Mtz^R strain 439 into Mtz^s strain 500. Note that the RdxA amino acid sequence is identical, indicating allelic exchange recombination occurred outside the rdxA locus. Other clinical isolates are included for comparison. The five matched pairs of isolates are grouped separately and the amino acid substitutions are listed in Table 3.

DETAILED DESCRIPTION OF THE INVENTION

In accordance with the present invention there are provided novel nitroreductases, having two or more cysteine residues, an alkaline pi greater than about 6.0, a preference for NADPH as an electron donor, and having the ability to convert a prodrug to one or more cytotoxic compounds. Preferably invention nitroreductases have a pi of about 7.99.

As used herein, prodrug refers to compounds of the general structure X-NO₂, wherein X is an organic radical of structure sufficient to impart to X-NO₂ a low redox potential. Preferably X-NO₂ has a redox potential in the range of about -500mV to about -350mV. Those of skill in the art will clearly recognize that a number of organic species are suitable for the X moiety, including, without limitation, pyrroles, furans, thiophenes, imidazoles, oxazoles, thiazoles, pyrazoles, pyridines, pyrimidines, purines, quinolines, isoquinolines, carbazoles, as well as substituted variants thereof. In one embodiment of the present invention, "prodrug" includes imidazoles, nitrofurazones, furanyls, and derivatives thereof such as nitroimidazoles, and the like. Preferred prodrugs include compounds used to treat Helicobacter infections such as metronidazole, nitazoxanide, and the like. An especially preferred prodrug is metronidazole. In a still another embodiment of the present invention, a prodrug is characterized by the ability to be converted to one or more hydroxylamines by action of invention nitroreductases.

In accordance with another aspect of the present invention, there are provided nitroreductases further characterized as being encoded by DNA having greater than about 90% homology with the H. pylori rdxA gene (see SEQ ID NO:l and Fig. 1). Preferably, invention nitroreductases contain a conserved amino acid motif common to the CNRs (QPWHF) as well as the positioning of a strategic cysteine residue (position 87, see SEQ ID NO:2). In a more preferred aspect of this embodiment, invention nitroreductases are isolated from microaerophilic bacterial species such as Helicobacter, Campylobacter, and the like. An especially preferred nitroreductase is the H. pylori nitroreductase (RdxA) and homologues thereof. Those of skill in the art will readily recognize that similar nitroreductases can be isolated from other Helicobacter species, including, H. acinonyx, H bilis, H. bizzozeronii, H. canis, H. cholecystus, H. cinaedi, H. felis, H. fennelli, H. heilmanni, H. hepaticus, H muridarum, H. mustelae, H. nemestrenae, H. pullorum, H. rodentium, H. salamonis, H suncus, H trogontum, and the like. The presently preferred nitroreductase is the RdxA of H. pylori strain HP950.

In accordance with another aspect of the present invention, there are provided conjugates comprising a targeting compound and a nitroreductase, as defined herein. In yet another aspect of the invention, there are provided conjugates wherein said targeting compound is covalently linked to a nitroreductase. As used herein, "covalently linked" refers to a bond between the targeting compound and nitroreductase wherein electrons are donated by one or more atoms of each to form the bond shared between the targeting compound and the nitroreductase. In a preferred aspect of the present invention, said targeting molecule is an antibody, to include monoclonal antibodies, and the like. Antibodies used in the present invention may be isolated and/or made with specificity cell surface antigens, precancerous cell surface antigens, cell surface antigens characteristic of autoimmune diseases (including for example, arthritis, Lupus, and other autoimmune diseases/conditions), tissue-specific antigens, organ-specific antigens, and the like. Those of skill in the art will readily recognize that antibodies, for use as targeting molecules may be generated with specificity to any cell population with characteristic antigenicity. Such antibodies, when conjugated with invention nitroreductases are contemplated embodiments of the present invention.

In accordance with another aspect of the present invention, there are provided nucleic acid molecules encoding the invention nitroreductases as defined herein. In a preferred embodiment of the present invention, said nucleic acid is greater than about 90%) homologous to the H. pylori rdxA gene (see SEQ ID NO:l and Fig. 1). In a presently preferred embodiment, the nucleic acid is homologous to the ORF shown in Fig. 1. In accordance with still another aspect of the present invention, said nitroreductase-encoding nucleic acid is expressed in a heterotypic cell. As used herein, "heterotypic cell" refers to a cell or virus other than that in which said nucleic acid is found in nature. Those of skill in the art will readily recognize that, with appropriate manipulation, the range of heterotypic cells in which invention nucleic acids can be expressed includes, bacteria, viruses, retroviruses, yeast, eukaryotic cells, and the like. Expression of invention nucleic acids in each of these cell types is contemplated by the present invention, as are the proteins so expressed. In accordance with another aspect of the present invention, there are provided methods for selectively killing or inhibiting the growth of target cells, said method comprising administering invention conjugates in conjunction with administration of a prodrug, as defined herein, wherein said nitroreductase converts said prodrug into one or more cytotoxic compounds, resulting in the killing or growth-inhibition of the target cells. Preferably, target cells are selected from bacterial, (retro)viruses, fungi, yeast, immune system cells such as T-cells, and B-cells, tissue cell, organ cells, diseased cells, tumor cells or neoplastic cells.

In still another embodiment of the present invention, there are provided pharmaceutical formulations comprising the nitroreductase, or conjugated nitroreductase as defined herein. In another aspect of this embodiment, pharmaceutical formulations will include a suitable carrier. Those of skill in the art will recognize that, depending upon indications, mode of administration and the intended recipient/patient, formulations can include a variety of carriers. Suitable carriers contemplated for use in the practice of the present invention include carriers suitable for oral, intravenous, subcutaneous, transcutaneous, intramuscular, intracutaneous, inhalation, and the like administration. Administration in the form of creams, lotions, tablets, dispersible powders, granules, syrups, elixirs, sterile aqueous or non-aqueous solutions, suspensions or emulsions, patches, and the like, is contemplated.

For the preparation of oral liquids, suitable carriers include emulsions, solutions, suspensions, syrups, and the like, optionally containing additives such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents, and the like.

For the preparation of fluids for parenteral administration, suitable carriers include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic 8 esters such as ethyl oleate. Such dosage forms may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. They may be sterilized, for example, by filtration through a bacteria-retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions. They can also be manufactured in the form of sterile water, or some other sterile injectable medium immediately before use. Suitable carriers may also include liposomes, microspheres, or latex beads, and the like.

Invention compounds can optionally be converted into non-toxic acid addition salts. Such salts are generally prepared by reacting the compounds of this invention with a suitable organic or inorganic acid. Representative salts include the hydrochloride, hydrobromide, sulfate, bisulfate, methanesulfonate, acetate, oxalate, valerate, oleate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napsylate, and the like. Such salts can readily be prepared employing methods well known in the art.

In another embodiment of the present invention, there are provided methods for detecting plasmid loss by a bacterium, said method comprising transforming a bacterium with a plasmid containing DNA encoding invention nitroreductases as described herein, and assaying for growth of said bacteria on nitroaromatic-containing media, wherein said nitroreductase, as inserted into said plasmid, is expressed in said bacteria, and identifying as having lost the plasmid, any of said transformed bacteria which grow on said nitroaromatic-containing media.

In yet another embodiment, there are provided methods for identifying substrates for nitroreductases as defined hereinabove. Methods according to this embodiment comprise transforming a host cell with a plasmid encoding said nitroreductase, and assaying for growth of said host cell on a medium contaimng the putative substrate, wherein said nitroreductase is expressed and converts any substrate present in said medium to one or more cytotoxic compounds such that said transformed cells will be killed or growth-inhibited, and identifying as a substrate any of said putative substrates causing killing or growth-inhibition of said transformed cells.

Also contemplated within the present invention is a kit for identifying whether a bacterial isolate expresses a nitroreductase as defined herein. Said kit comprising a substrate for said nitroreductase, wherein said nitroreductase converts said substrate into one or more detectable products, and a means for detecting said product(s).

Typically, bacteria contain several different nitroreductases including flavin and ferredoxin reductases that may exhibit nitroreductase activity (Zenno et al, 1996a,b). One relatively close homologue of rdxA, with 25% protein-level identity over 181 amino acids, isfrxA (HP0642), which encodes a NAD(P)H flavin reductase (FrxA) similar to the flavin reductase of Haemophilus influenzei (Tomb et al, 1997). The results presented herein suggest that FrxA does not contribute significantly to Mtz susceptibility or resistance. In support of the latter hypothesis, it has also been discovered that t efrxA gene cloned in the pBluescript plasmid vector does not affect p the intrinsic high resistance of E. coli to Mtz. As even Mtz strains of H. pylori become susceptible to Mtz under anaerobic conditions (Smith and Edwards, 1995), perhaps FrxA and/or other ferredoxin and flavin reductases, such as those found in the annotation of the H pylori genome sequence (Tomb et al, 1997), may contribute to the activation of Mtz under anaerobic conditions.

Some investigations of metronidazole resistance focused on the metabolic enzymes of H pylori; in particular, on pyruvate:ferredoxin/flavodoxin oxidoreductase (POR) and α-ketoglutarate oxidoreductase (KOR) (Hoffman et al, 1996), in part because studies in anaerobes had shown POR to be responsible for Mtz activation (Moreno et al, 1983; Narikawa, 1986 Lockerby et al, (1991). Our studies showed that POR and KOR activities of Mtz strains of H. pylori were repressed in bacteria that had been cultured in the presence, but not in the absence, of Mtz (Hoffman et al, 1996). This indicated that these reductases were regulated by Mtz, which is consistent with a model in which H. pylori POR and KOR mediate Mtz toxicity. However, 10 those experiments did not test whether this, or any of several other changes that have been identified to date (see Hoffman et al, 1996; Smith and Edwards, 1997), is a primary effect, and the cause of resistance, or a secondary consequence of other metabolic perturbations that Mtz elicits. Similarly, although Mtz mutants are easily derived from many Mtz strains in the laboratory, the genetic basis for naturally occurring resistance, whether mutation in a normal chromosomal gene or by acquisition of a new 'resistance' gene, was unknown.

The basis of susceptibility and resistance to the antimicrobial agent metronidazole (Mtz) in H. pylori has been examined. Experiments indicate (i) that the toxicity of Mtz for H. pylori likely depends on its reduction to hydroxylamine by an oxygen-insensitive, chromosomally encoded NADPH nitroreductase (rdxA; HP0954 in the genome database) (Tomb et al, 1997); (ii) that resistance results from mutational inactivation of rdxA and not from the acquisition of foreign resistance genes (in contrast to common mechanisms of resistance against other antibiotics and bacterial species) (Levy, 1992). Mtz strains display no significant changes in metabolic or growth capacity compared with isogenic Mtz strains in culture (Hoffman et al, 1996).

Four results established the importance of a functional rdxA gene in Mtz , and rdxA inactivation as the general mechanism of Mtz in H. pylori. First, a mutant allele o rdxA was found using a DNA transformation strategy: one cosmid in a library made from a Mtz^R clinical isolate was found to transform a Mtz^s recipient to Mtz^R; subcloning from this cosmid, and further transformation identified the segment responsible for Mtz , and DNA sequencing revealed rdxA, a nitroreductase gene with significant protein level homology to the CNRs of enteric bacteria. The allele ofrdxA that was responsible for transformation of the Mtz S strain to Mtz R in these first experiments contained a nonsense (translational stop) codon 14 codons before the 3' c end of the ORF (as defined by sequences ofrdxA genes from Mtz strains). Second,

R S

E. coli, which is normally Mtz , was rendered Mtz by cloned rdxA genes from each c _ p to of 8 Mtz H. pylori strains, but not by cloned rdxA genes from any of 8 Mtz strains 11 contain mutant (inactive) rdxA genes. DNA sequencing showed that point mutations (missense and nonsense) at other sites in rdxA were responsible for rdxA inactivation in these strains. Third, introduction ofrdxA from a Mtz H pylori strain on a shuttle p c vector plasmid rendered a formerly Mtz recipient strain Mtz , this further illustrates that a functional RdxA nitroreductase contributes to the Mtz phenotype of normal H. pylori. Fourth, H. pylori derivatives with camR inserts in their rdxA genes, and p p that had been selected solely by their Cm phenotype, exhibited a typical Mtz phenotype. Collectively, these results showed that a functional RdxA nitroreductase is key to the normal Mtz phenotype of wild-type H. pylori, and, conversely, that rdxA p inactivation is necessary and sufficient for Mtz in this species.

It is believed that the multiple cysteine residues of RdxA together with the more alkaline nature of the protein may contribute to both a lower redox potential and a greater substrate specificity of this enzyme for Mtz. These properties might be achieved through the formation of disulphide bonds or the chelation of metal cofactors, which might form a flavin-independent catalytic center. It has been suggested that a disulphide bond of the CNR homodimer may participate as an electron acceptor in the oxidation of NAD(P)Η (Inouye, 1994; but see Zeno et al., 1996a) and in an alkyl hydroperoxide reductase from S. typhimurium, two cysteine residues participate in catalysis (Ellis and Poole, 1997).

In studies of H. pylori from human populations at high risk of infection (Peru,

R S

Lithuania), pairs of strains have been identified, one Mtz and one Mtz , that were closely matched in RAPD fingerprint. Although rdxA genes from unrelated strains

S R differed in DNA sequence by 5% on average, the rdxA genes from Mtz and Mtz isolates from the same person differed by only one or a few base substitutions. This p result indicated that Mtz resulted from de novo mutation, and not by gene transfer p _# from an unrelated Mtz strain, even although at least transiently mixed infection seems to be quite common in these high risk (Peruvian and Lithuanian) societies. 12

Nitroreductases from other organisms are classified as oxygen sensitive or insensitive based on whether the substrates are reduced in one- or two-electron transfer reactions respectively. One-electron transfer reductions of the nitro group of a particular compound produces the nitro-anion radical, which in the presence of oxygen generates superoxide anions and regeneration of the 5 -nitro group (Moreno et al, 1983; Edwards, 1993). It has been suggested that aerobes and facultative anaerobes are resistant to Mtz because under aerobic conditions redox cycling leads to regeneration of Mtz (Smith and Edwards, 1995). Indeed, the Mtz of Actinobacillus actinomycetemcomitans under anaerobic, but not aerobic conditions, is consistent with the concept of redox cycling and the nitroreductase activity implicated in Mtz of this species may be of the oxygen-sensitive type (Pavicic et al, 1995). In contrast, the Mtz of H. pylori was not affected by growth under different oxygen tensions; suggesting that one electron transfer is probably not involved in Mtz reduction in this microaerophilic bacterium (Smith and Edwards, 1995). The latter interpretation is supported by the present finding that an oxygen-insensitive nitroreductase is c responsible for the Mtz of H. pylori. Microaerophiles in general are susceptible to Mtz, and display patterns of resistance similar to those noted for H. pylori (Hoff and Stricht-Groh, 1984; Lariviere et al., 1986), suggesting that homologues ofrdxA may be found in these other species. p Naturally occurring Mtz is associated with a Mtz-inducible depression of activity of pyruvate oxidoreductase (POR) and as little as 3-5μgml-' of Mtz in the p culture medium is sufficient to abolish POR activity of Mtz strains (Hoffman, et al., 1996). This depression of POR was also seen in a Mtz strain containing a camR p p insertion in rdxA, a strain selected by its Cm , not by its Mtz . This result indicates that repression of POR activity is not due to a secondary mutation selected by enhancement of Mtz . Based on studies with anaerobes, POR should also be capable of reducing Mtz (Lockerby et al., 1985), and it is proposed that the POR of H. pylori acts similarly. This thinking suggests that POR activity could be responsible for the transient growth inhibition and limited killing seen when Mtz H. pylori are first exposed to Mtz (Lacey et al., 1993). The ability to turn off synthesis or accumulation 13 of POR in response to Mtz might then be an important component of resistance. Just how this putative regulatory mechanism operates is not yet known, but it is attractive to imagine that it involves a response to the chemical (hydroxylamine induced) damage to DNA, protein or other macromolecules, analogous to the bacterial response to alkylation damage (see Volkert, 1988, 1989). Such a mechanism might also be advantageous during normal growth (without Mtz treatment), helping safeguard H. pylori against deleterious effects of reduction of other nitroaromatic compounds that might be encountered in situ such as hydroxylamine adducts that might result from the action of nitric oxide with amines.

The majority of nitroreductases thus far studied are of the oxygen-insensitive type and are capable of reducing nitroaromatic compounds through sequential two- electron reductions, resulting in nitroso intermediates and hydroxylamine end products (Lindmark and Muller, 1976; Bryant and Deluca, 1991). This interpretation is supported by the direct demonstration that the enteric homologues of RdxA (CNRs NfsB of E. coli, Cnr of Salmonella typhimurium, and NfsB of E. Cloacae) reduce 4- and 5 -nitro compounds by two-electron transfer reactions (Bryant and Deluca, 1991; Zenno et al, 1996a;, Yamada et al, 1997). The substrate specificity of the CNRs is often a function of the redox potential of the 5-nitro group (Bryant and Deluca, 1991), and in this regard the intrinsic resistance of enteric bacteria to Mtz is due to the very low redox potential of Mtz (Narikawa, 1986). However, reduction of Mtz and other nitroaromatic compounds to mutagenic end products by S. typhimurium has been demonstrated in the Ames test (Lindmark and Muller, 1976). Null mutations in the S. typhimurium gene for Cnr, an rdxA homologue, renders S. typhimurium resistant to the mutagenic effects of nitro-containing compounds (Yamada et al, 1997). It appears that CNR activates Mtz in these microbes, generating hydroxylamine at levels that are too low to cause much lethality yet are still sufficient for mutagenesis. The Mtz^s of E. coli strains containing cloned H. pylori rdxA genes, for which Mtz reductase activity was measured in two strains, suggests that lethality must be due to the greater production of hydroxylamine from Mtz by the H. pylori RdxA nitroreductase. 14

The invention will now be described in greater detail by reference to the following non-limiting examples.

EXAMPLES

Example 1 : Identification of a nitroreductase that confers Mtz sensitivity in H. pylori

The gene responsible for naturally occurring Mtz in H pylori was sought using a strategy based on an earlier finding (Wang et al, 1933) that DNA from Mtz^R

S R clinical isolates could transform Mtz strains to Mtz . To maximize the chance of p p finding the Mtz determinant, independent of whether naturally occurring Mtz is caused by a particular type of allele of a normal chromosomal gene, or by an added gene that is absent from the genomes of Mtz strains, a cosmid cloning approach was employed.

Bacterial strains and growth conditions

The H. Pylori isolates used in this study were isolated from human gastric biopsy samples and were obtained from the Victoria General Hospital, Halifax, Nova Scotia, Canada, and have been previously described (Hoffman et al, 1996). Paired Mtz^R and Mtz^s from the same patient that were found to be closely matched in overall genotype had been isolated from biopsies from Peruvian and Lithuanian patients, which were kindly provided by Drs. R. H. Gilman and H. Chalkauskas respectively. Bacterial strains were grown at 37°C on Brucella agar plates supplemented with 10% fetal calf serum (FCS) in a microaerobic incubator maintained at 7%O₂, 5% CO₂. Liquid cultures were grown in Brucella broth with 10% FCS in 125ml screw-capped flasks; the medium was equilibrated with 7%O₂, 5% CO₂ in the microaerobic incubator for 1 h before inoculation, and then the flasks were sealed and placed on a rotary shaker at 150r.p.m. Unless otherwise indicated, metronidazole-resistant strains were grown with 18μgml- of Mtz, which is one half the minimal inhibitory concentration. Bacteria were harvested by centrifugation after 3-4 days of growth, 15 and either used immediately or stored as a pellet at -70°C. E. coli strains DH5α (BRL) and ER1793 (New England Biolabs) were grown on Luria-Bertani (LB) agar plates supplemented with the appropriate antibiotics.

Cosmid library construction and screening p Genomic DNA was prepared from Mtz strain 439 and partially digested with

Sau3A to generate a population of DNA fragments in the 20-45kb range, as described previously (Hoffman et al, 1989). These DNA fragments were cloned into BamHΪ- cleaved Loristό, a cloning vector that has been useful for making cosmid libraries from other H. pylori strains, and the ligated DNA was packaged into λ phage particles (Bukanov and Berg, 1994). Cosmids were recovered after infection of E. coli ER1793, which is deficient in restriction modification systems, and transductants carrying cosmid clones were selected on LB agar containing 3Oμgml- of kanamycin. p _t

Kan colonies were picked into wells in microtitre dishes. Cosmid DNAs were prepared in batches from the growth of 96 clones per microtitre plate in 50ml of LB broth and the cosmid

Natural transformation and isolation of spontaneous metronidazole-resistant mutants c p

Transformation of Mtz and Mtz was carried out using a modification of the method of Wang et al. (1993), as follows. Log phase recipient cells (strains 500 or 1134) were prepared in 10ml of broth from overnight culture in Brucella broth. The bacterial pellet was resuspended in 0.5ml of TE (Tris EDTA) buffer, and the suspension was spotted onto Brucella agar plates supplemented with 10% FCS. After 3-4h incubation, 3-8μg of chromosomal, cosmid or plasmid DNA was spotted onto the bacterial growth followed by incubation for 12-16h. The bacteria were scraped from the agar surface and suspended in a minimal volume of TE and aliquots were then spread on Brucella agar containing 18μgml- metronidazole. Transformed colonies were isolated from these plates after 3-4 days' incubation. Spontaneous 16

Mtz mutants were isolated by spreading 0.10ml of turbid cultures (5x.l0 cells) on Brucella agar containing between 8 and 18μgml- Mtz.

Low-level transforming activity was found reproducibly in one of the nine pools tested (11 transformant colonies, vs. 15 in a control using 15 μg of strain 439 genomic DNA). No transformants were obtained with cosmid DNAs from any of p eight other microtitre plates. The cosmid responsible for Mtz -transforming activity was identified in two more transformation steps: first using 12-member pools prepared from each of the eight rows in this microtitre plate; and then using individual cosmids from the one active row.

Details of DNA subcloning and sequencing

EcøRl digestion generated four DNA fragments from the cosmid containing

R • R • the Mtz determinant, and the Mtz -transforming activity was localized to one of them, a 2.3kbp fragment. DNA sequencing was carried out on both strands, manually using the Sequenase kit (Amersham) or by automated methods on a Licor DNA sequencer at the Institute for Marine Biosciences facility of the National Research Council of Canada (Halifax, NS). The sequence was assembled and analyzed using the Wisconsin Group GCG software (Devereau et al, 1984) and BLAST search routines to assist identification of ORFs and other sequence features.

Two open reading frames (ORFs) were found in the 2.3kbp fragment. One ORF (corresponding to HPO955 in the entire H. pylori genome sequence, (Tomb et al, 1997)) had strong protein-level homology to the gene for prolipoprotein p diacyglycerol transferase Igt and seemed unlikely to be involved in Mtz . The second ORF had protein-level homology to classical oxygen-insensitive NAD(P)H nitroreductases (CNRs) of several other Gram-negative bacteria (see Table 1) and was a good candidate because some of its homologues are known to reduce metronidazole or related compounds (Lindmark and Muller, 1976; Yamada et al, 1997). This H. pylori gene corresponds to the ORF designated HP0954 in the full genome sequence (Tomb et al, 1997) and, interestingly, exhibits 54% similarity with another 17

ORF (HP0642) that encodes a NAD(P)H flavin nitroreductase (f ' rxa ' herein), also a CNR homologue. The sequences have been deposited in GenBank (AFO12552, AFO12553).

Table 1. Similarity of RdxA to other classical nitroreductases.

Bacterial Strains Protein Per cent Identity Per cent Similarity

Haemophilus NtsB 25 48 influenza

Enterobacter cloacae NfnB 30 50

Salmonella Cnr 30 50 typhimurium

Helicobacter pylori FrxA 27 54

Escherichia coli NfsB 28 49

The inferred RdxA product from Mtz H. pylori strain 439 is 196 amino acids long. PCR amplification and sequencing of the corresponding segment from the Mtz strain 500 revealed an ORF that is 14 codons longer at the 3' end (210 codons, see Fig. 1). The rdxA gene from a Mtz^R transformant of strain 500 (strain HP 1107) that was made with genomic DNA from strain 439 was identical in DNA sequence to that p of the 439 parent strain (Fig. 2). These results indicate that Mtz H. pylori can result from inactivation ofrdxA, which in strain 439 occurred by a nonsense mutation that resulted in a truncated RdxA protein.

The WT rdxA gene was 630bp in length and had a Shine-Dalgarno sequence 5bp upstream of the start codon. The CNR proteins of the enteric bacteria are acidic proteins, including HP0642 CfrxA ') (pI=5.4-5.6), and generally contain one to two cysteine residues. However, RdxA is a basic protein (pl=7.99) and contains six cysteine residues. One of the cysteine residues (position 87) is conserved in the CNR 18 proteins of the enterics. The cysteine located at position 159 is in a motif (L/IDSCI/PI) shared with the inferred product of fix A. Another motif common to all of the CNRs is QPWHF (PW is absolutely conserved) located within a highly conserved region between positions 43-59 in RdxA.

Example 2: Nitroreductase activity and rdxA expression in E. coli c p

Cell-free extracts from Mtz and Mtz strains of H. pylori were screened for nitroreductase activity using standard assays that use either menadione or nitrofurazone as electron acceptors (Bryant and Deluca, 1991; Zenno et al, 1994) (data not presented). No significant differences in the nitroreductase activities of c p either isogenic pairs of Mtz and Mtz strains or of various clinical isolates were detected, suggesting that H. pylori most probably possesses multiple nitroreductases. The latter hypothesis is supported by known genes present in the full genome sequence {e.g.,frxA (H0642), (Tomb et al, 1997)), and by the fact that multiple nitroreductases have been found by others in enteric bacteria (Zenno et al, 1996a,b). c No Mtz reductase activity was detected in crude extracts from Mtz strains of

H pylori, independent of whether NADPH or NADH were used as electron donors; this is consistent with earlier observations (Hoffman et al, 1996). The inability to detect Mtz reductase activity in cell-free extracts of H pylori might be attributable to oxidation of key components during the preparation, or to an inability of the assays used to detect very low levels of Mtz reductase activity.

Because E. coli strains are intrinsically resistant to Mtz (>300 μgml- ), the possibility that expression of rdxA in E. coli might render the organism susceptible to Mtz was explored. It was found that the cloned τdxA genes (rdxA cloned in a pBluescript vector, downstream of the lac promoter) from each of 8 Mtz H pylori c ι strains, indeed rendered E. coli Mtz (killing by 10-60 μgml- ) during aerobic growth on LB agar. In contrast, equivalent plasmid clones made with rdxA genes from each of eight Mtz^R H. pylori had no effect on the intrinsic high level of Mtz resistance of the E. coli host. 19 Recombinant rdxA screen for Mtz

E. coli DH5 containing pBluescriptSKπ /4 clones from all H pylori strains c used in this study were screened for Mtz on Luria Bertani medium containing a range of Mtz concentrations from 0 to 60μgml- . The plates were streaked for isolation of colonies or a 1 : 1 :00 dilution of a 0.40D₆₆₀ broth culture was spread onto the medium. The plates were incubated under aerobic conditions at 37°C and then scored for growth at 16-24h.

Each of the strains used in the rdxA sequence analyses (Fig. 2) was tested in this way, yielding results that completely supported the use of in vivo assays in E. coli as a surrogate for monitoring the rdxA activity of H. pylori. An in vivo assay offrxA (cloned from the 26695 strain of H. pylori into pBluescript) in E. coli indicated that the FrxA (flavin reductase) activity did not alter the intrinsic resistance of E. coli to Mtz.

The cloned rdxA gene from the H. pylori strain that rendered E. coli most susceptible to Mtz (strain 950) was tested for nitroreductase activity by spectrophotometric assay. Cell-free extracts from E. coli harboring rdxA from this strain exhibited 40-fold higher than background NADPH-dependent nitroreductase activity using metronidazole as the electron acceptor, and assayed by following either Mtz reduction or oxidation of NADPH (Table 2). No detectable reductase activity was found using NADH instead of NADPH as the electron donor, nor was any detected using extracts of.E. coli carrying pBluescript by itself or with an rdxA mutant (Mtz allele from strain 1043). These results indicate that RdxA protein can reduce Mtz and differs from other CNRs in showing specificity for NADPH. Among the known nitroreductases, only NfsA of E. coli shows specificity for NADPH (Zenno et al, 1996b), but this gene exhibits no DNA- or protein-level homology with RdxA (or with FrxA, HPO642) of H. pylori. These results indicate that expression of WT rdxA, but noXfrxA in E. coli; causes a marked increase in susceptibility to Mtz and 20 support the conclusion that rdxA function is responsible for the Mtz of wild-type p

H pylori, and that Mtz in this pathogen results from rdxA inactivation.

Table 2. Metronidazole reductase activity of RdxA nitroreductase.

nmol min^" mg^" protein nmol min^" mg^" protein

Isolate Mtz (A₃₂₀) NADPH CA_Η0

pBSK 0.09 0.62

pBS950 9.23 +/-0.87 14.13 +/- 0.70

pBS1043 0.31 0.40

Metronidazole reduction was measured in crude extracts of E. coli strain JF626 grown aerobically in LB broth. pBSK is pBluescript vector control; pBS950 is WT rdxA cloned into pBSK and pBS1043 is MtzR rdxA cloned in pBSK. The assay contained NADPH and Mtz. The enzymatic reaction was followed at 320 nm to measure Mtz reduction and at 340 nm to measure NADPH oxidation. The values are corrected for NADPH oxidase activity. No activity was found when NADH was used as substrate.

Enzyme assays

Cell-free extracts were prepared from bacteria that had been grown to mid to late log phase in the appropriate medium and where indicated, either in the presence or absence of 18μgml^" Mtz. The general protocol for preparation of cell-free extracts has been previously described (Hoffman et al, 1996). All enzyme assays were 21 carried out at 25 °C in 1 ml volumes in a modified Cary-14 Spectrophotometer equipped with an OLIS data acquisition system (On Line). Nitroreductase activity was assayed with NADH or NADPH at 340 nm (extinction coefficient, 6.22 mM^"1 cm ) or by following the reduction of metronidazole at 320 nm (E=9.2mM^" cm^" ). The reaction mixture contained Tris/acetate (lOOmM Tris-HCl, 50mM acetate) pH 7.0, 0.05mM Mtz and 0.3mM NADPH or HADH, POR (EC 1.2.7.1) was assayed under anaerobic conditions with 74mM potassium phosphate (pH 7.3), lOmM sodium pyruvate, 5mM benzyl viologen, 0.18mM coenzyme A (CoA), and 5μM thiamine PP as described previously (Hoffman et al, 1996). Reduction of benzyl viologen was followed at 546nm and specific activity was determined for the reaction using an extinction coefficient of 9.2mM^" cm . Specific activities were reported as nmoles per min per mg of protein. Protein determinations were performed using the Bradford procedure (Bio-Rad) with bovine serum albumin as the standard.

Example 3 : Sequence analysis ofrdxA in closely related pairs ofMtx and Mtz strains

R •

To assess how often Mtz is acquired by de novo mutation vs. rdxA gene p transfer from an unrelated strain that is already Mtz , rdxA genes from infections that p c p were mixed with respect to Mtz /Mtz , and in which the Mtz and Mtz isolates seemed to be very closely related based on arbitrarily primed PCR cloning/sequencing have been studied. rdxA sequences from various strains of H pylori were amplified and cloned into pBluescript using primer pairs Mtz6EF (forward) 5'- TGAATTCGAGCATGGGGCAG and reverse primer Mtz^RBgl 5'- AGCAGGAGCATCAGATAGATCTGADNA.

With each of five such pairs of isolates studied, the PCR amplified rdxA- containing segment obtained was about the same size («937 bp). This implied that resistance was due to point mutations and not to insertion, deletion or other p rearrangement. DNA sequence analysis showed that the rdxA genes from Mtz and Mtz^s members of each pair were closely related but differed by 1-3 bp in the 630-bp- 22 long gene (resulting in one or two amino acid replacements) in each case (see Fig. 2 and Table 3). Because unrelated rdxA genes differed on average by about 5% (28-34 p bp of 630 bp), this indicates that Mtz was due to de novo mutation, not horizontal gene transfer from another strain. p c Table 3. Types of point mutations in matched pairs of Mtz and Mtz strains and

Strain A-G C-T Other Amino Acid Substitution

H2amt 1 Arg-Gly

Blamt 3 Tyr-Cys, Ala-Thr

21cmt 2 Gln-Arg, Lys-Glu

12mtz 1 Ala-Thr

10amt3 1 1 1 Gly-Val

439/500³ 8 15 4 (8aa)

Comparison of divergence in rdxA of unrelated H. pylori strains 439 and 500. Listed are the number of amino acid changes between these strains.

Four of the five alleles resulted in single amino acid changes in the inferred 210-amino-acid -long RdxA protein:G— V at position 145 in mutant 10amt3; A — T at position 180 in 12mtz; R — G at position 200 in H2mt; and K — E at position 63 in strain 21cmt. The fifth rdxA mutant allele (Blamt) would encode a protein with two amino acid sequence changes, Y — C at position 47, which is in a region that is highly conserved at CNRs (position 43-57), and also A — T at position 143. 23

Example 4: rdxA-inactivation is sufficient for Mtz : allelic exchange mutagenesis and complementation

Based on finding non-functional rdxA alleles in each Mtz clinical isolate studied, it was tested whether rdxA inactivation is also sufficient for resistance, or whether additional mutations are also needed.

pDH26, a chimeric shuttle vector, was kindly provided by Dr. Rainer Haas. H pylori strain 500 sequences spanning the rdxA ORF were excised from pBluescript by EcoRY and Sail digestion and subcloned into similarly restricted pDH26. H pylori strain 1061 was made MtzR by natural transformation of pBluescriptSKnbC4 originating from Mtz strain 439. The pDH26rdxA plasmid was introduced into strain

R R

1061 Mtz by natural transformation and Cm colonies were scored on BA

1 R supplemented with 15 μgml^" of CM. CM colonies were subsequently screened for Mtz^s phenotype on Brucelia agar containing CM and 18 μgml^"1 Mtz to demonstrate dominance of wild-type rdxA through loss of the Mtz phenotype.

Allelic exchange mutagenesis and complementation

A 937bp PCR amplicon of H. pylori Mtz strain H2csr, generated with p oligonucleotide primers MtzόEF and Mtz Bgl and cloned into pBluescript-SK (a non- replicating vector), was digested with Sphl, which deleted an approximately 160bp fragment from an internal region ofrdxA (see Fig. 1 for Sphl sites). After gel purification and generation of blunt ends with T4DNA polymerase, an EcoRV restricted cam cassette originating from Campylobacter coli (Wang and Taylor, 1990) was ligated into rdxA to create pBluescriptrdxA: : cam. After transformation into DH5α and plasmid purification, pBluescriptrdxA: .cam was introduced into Mtz p

H. pylori strain 26695 by natural transformation. Cm colonies were picked and then

R R scored for Mtz . Each of the 30 Cm transformants tested was able to grow on Mtz- containing medium (18 μg ml^" Mtz), and thus had acquired high-level Mtz . This p showed that simple inactivation ofrdxA is sufficient for Mtz in H. pylori. 24

Previous studies had shown that growth of Mtz^R strains in Mtz-containing medium resulted in disappearance of POR activity, another enzyme that putatively can c reduce Mtz, and therefore that should render H pylori Mtz whenever it is active (Hoffman et al, 1996). In the present experiments, it was determined that growth of the rdxA::camR insertion mutant strain (which had been selected solely by its Cm phenotype) in Mtz-containing medium also resulted in the disappearance of POR activity. In addition, during growth in Mtz-free medium, this mutant strain exhibited only half as much POR activity as its isogenic rdxA (Mtz ) parental strain. Thus, mutations in rdxA may indirectly affect the level of POR activity through a potentially important mechanism.

In complementary experiments, the rdxA gene from the Mtz strain 500 was p

PCR amplified and cloned into pDH26, a Cm shuttle vector that is stably maintained p in H. pylori (obtained from R. Haas), and the construct was transformed into the Mtz p strain 1061R. Strain 1061 had been made Mtz by transformation of a mutant rdxA

R R allele originating from Mtz strain 439. Each of the eight Cm colonies tested c exhibited a Mtz phenotype, and rdxA -containing plasmid DNAs were easily reisolated from each of them; this indicates that the rdxA nonsense mutant allele is recessive, as expected. These results further establish that null mutations in just a single gene, rdxA, are responsible for Mtz in H. pylori.

While the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that modifications and variations are within the spirit and scope of that which is described and claimed.

Claims

25 That which is claimed is:

1. A conjugate comprising a targeting compound and a nitroreductase, said nitroreductase having:

(a) a pi greater than about 6.0,

(b) 2 or more cysteine residues, and (c) a preference for NADPH as an electron donor; wherein said nitroreductase is capable of converting a prodrug to one or more cytotoxic compounds.

2. A conjugate according to claim 1, wherein said targeting compound is covalently linked to said nitroreductase.

3. A conjugate according to claim 1, wherein said targeting compound is an antibody.

4. A conjugate according to claim 3, wherein said antibody is a monoclonal antibody.

5. A conjugate according to claim 3, wherein said antibody is specific for tumor cell surface antigens, precancerous cell surface antigens, cell surface antigens characteristic of autoimmune diseases, selected tissue-specific antigens or selected organ-specific antigens.

6. A conjugate according to claim 1, wherein said prodrug is a compound used to treat Helicobacter infections. 26

7. A conjugate according to claim 1, wherein said prodrug has the structure:

X-NO₂ and a redox potential in the range of about -500mV to about -350mV.

8. A conjugate according to claim 7, wherein X is selected from pyrroles, furans, thiophenes, imidazoles, oxazoles, thiazoles, pyrazoles, pyridines, pyrimidines, purines, quinolines, isoquinolines, carbazoles as well as substituted variants thereof.

9. A conjugate according to claim 7, wherein X is an imidazole.

10. A conjugate according to claim 7, wherein said prodrug is metronidazole.

11. A conjugate according to claim 7, wherein said prodrug is nitazoxanide.

12. A conjugate according to claim 7, wherein said prodrug is a nitrofurazone.

13. A conjugate according to claim 1, wherein said nitroreductase is isolated from a microaerophilic bacterium, said microaerophilic strain having a sensitivity to nitro-containing compounds with a redox potential in the range of about -500mV to about -350mV.

14. A conjugate according to claim 13, wherein said microaerophilic bacterium is Helicobacter.

15. A conjugate according to claim 13 , wherein said microaerophilic bacterium is Camphylobacter. 27

16. A conjugate according to claim 13, wherein said microaerophilic bacterium is an H. pylori strain.

17. A conjugate according to claim 16, wherein said H. pylori strain is HP950.

18. A nitroreductase having :

(a) a pi greater than about 6.0

(b) 2 or more cysteine residues,

(b) a preference for NADPH as an electron donor; and wherein said nitroreductase is capable of a prodrug to one or more cytotoxic compounds.

19. A nucleic acid encoding the nitroreductase of claim 18.

20. A nucleic acid having greater than about 90%> homology to the ORF in SEQ ID NO: 1.

21. A nucleic acid according to claim 19, wherein said nucleic acid is expressed in a heterotypic cell.

22. A nucleic acid according to claim 21 , wherein said heterotypic cell is a bacterium, a virus, a retro-virus, a yeast, or a eukaryotic cell.

23. A nucleic acid according to claim 22, wherein said bacterium is E. coli. 28

24. A method for selectively killing or inhibiting the growth of target cells, said method comprising the administering of a conjugate according to claim 1, wherein administration of said conjugate is in conjunction with administration of a prodrug, said prodrug having a redox potential in the range of about -500mV to about -350mV, and wherein said nitroreductase converts said prodrug into one or more toxic compounds.

25. A method according to claim 24, wherein said target cells are selected from bacterial cells, viral cells, fungal cells, yeast cells, T-cells, B-cells, tissue cells, organ cells, diseased cells, tumor cells or neoplastic cells.

26. A method according to claim 24, wherein said prodrug has the following structure: X-NO₂, and a redox potential in the range of about -500mV to about -350mV.

27. A method according to claim 26, wherein X is selected from pyrroles, furans, thiophenes, imidazoles, oxazoles, thiazoles, pyrazoles, pyridines, pyrimidines, purines, quinolines, isoquinolines, carbazoles, and substituted variants thereof.

28. A pharmaceutical formulation comprising a nitroreductase according to claim 18, optionally conjugated with a targeting compound, and a suitable carrier.

29. A pharmaceutical formulation comprising a conjugate according to claim 1 , and a suitable carrier.

30. A therapeutic method for delivering to a patient a pharmaceutical formulation according to claim 28. 29

31. A method according to claim 27, wherein said carrier is selected from liposomes, latex beads or microspheres.32. A method for detecting plasmid loss by a bacteria, said method comprising transforming said bacteria with a plasmid encoding a nitroreductase, and assaying for growth of said bacteria on a nitroaromatic-containing media; wherein said nitroreductase, as inserted into said plasmid, is expressed in said bacteria, said nitroreductase having: a pi greater than about 6.0 greater than 2 cysteine residues, and a preference for NADPH as an electron donor; wherein said nitroreductase is capable of reducing said nitroaromatic compound to one or more cytotoxic compounds, and identifying as having lost said plasmid, any of said transformed bacteria which grow on said nitroaromatic-containing media.

30

32. A method for detecting plasmid loss by a bacteria, said method compirsing transforming said bacteria with a plasmid encoding a nitroreductase, and assaying for growth of said bacteria on a nitroaromatic-containing media; wherein said nitroreductase, as inserted into said plasmid, is expressed in said bacteria, said nitroreductase having: a pi greater than about 6.0 greater than 2 cysteine residues, and a preference for NADPH as an electron donor; sherein said nitroreductase is capable of reducing said nitroaromatic compound to one or more cytotoxic compounds, and identifying as having lost said plasmid, any of said transformed bacteria which grow on said nitroaromatic-containing media.

33. A method for identifying substrates for a nitroreductase according to claim 18, said method comprising transforming a host cell with a plasmid encoding said nitroreductase, and assaying for growth of said host cell on a medium containing the putative substrate, wherein said nitroreductase converts any substrate present in said medium to one or more cytotoxic compounds such that said transformed cells will be killed or growth-inhibited, and identifying as a substrate any of said putative substrates causing killing or growth-inhibition of said transformed cells. 31

34. A kit for identifying a bacterium that expresses a nitroreductase, said kit comprising a substrate for said nitroreductase, wherein said nitroreductase converts said substrate into one or more detectable products.

35. A kit according to claim 34, wherein said nitroreductase is the H. pylori rdxA gene product.

36. A kit according to claim 35, wherein said nitroreductase converts said substrate into one or more cytotoxic compounds.

37. A kit according to claim 36, wherein said substrate is metronidazole.