US20080249029A1 - Methods for Treating Skin Pigmentation - Google Patents
Methods for Treating Skin Pigmentation Download PDFInfo
- Publication number
- US20080249029A1 US20080249029A1 US11/929,488 US92948807A US2008249029A1 US 20080249029 A1 US20080249029 A1 US 20080249029A1 US 92948807 A US92948807 A US 92948807A US 2008249029 A1 US2008249029 A1 US 2008249029A1
- Authority
- US
- United States
- Prior art keywords
- alkyl
- amino
- substituted
- carboxy
- hydroxy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
- 0 *N([H])C([1*])([2*])C(=O)CC Chemical compound *N([H])C([1*])([2*])C(=O)CC 0.000 description 5
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
- A61K8/44—Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
- A61K8/14—Liposomes; Vesicles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
- A61K8/41—Amines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
- A61K8/42—Amides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/46—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing sulfur
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
- A61K8/4906—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom
- A61K8/4926—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom having six membered rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/67—Vitamins
- A61K8/676—Ascorbic acid, i.e. vitamin C
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/67—Vitamins
- A61K8/678—Tocopherol, i.e. vitamin E
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9794—Liliopsida [monocotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/16—Emollients or protectives, e.g. against radiation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/04—Preparations for care of the skin for chemically tanning the skin
Definitions
- This invention is related to methods and compositions for bringing about skin pigmentation and/or for causing skin depigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin.
- Skin coloring has been of concern to human beings for many years.
- the ability to remove hyperpigmentation, such as found in age spots, freckles or aging skin generally, is of interest to individuals desiring a uniform complexion. In certain areas of the world, general body whitening is desirable. There are also hypopigmentation and hyperpigmentation disorders that are desirable to treat.
- the ability to generate a tanned appearance without incurring photodamage due to solar radiation is important to many individuals.
- There have been many methods proposed to accomplish depigmentation, as well as to accomplish darkening of the skin For example, kojic acid, hydroguinone, retinoids and other chemical compounds have been used for depigmentation. Dihydroxyacetone and like chemical compounds have been utilized for their ability to “tan” the skin without exposure to the sun.
- TRP-1 is the most abundant glycoprotein in melanocytes.
- Tyrosinase and the TRP's share structural and biological properties with the lysosomal-associated membrane protein (LAMP) gene family, therefore their targeting to the melanosomal membrane might induce their activation.
- LAMP lysosomal-associated membrane protein
- a phosphorylation/dephosphorylation reaction at the cytoplasmic tails of these proteins could be involved in the regulation of melanogenesis.
- the beta isoform of the Protein Kinase C(PKC) family has been shown to regulate human melonogenesis through tyrosinase activation. Gene expression of tyrosinase, TRP-1 and TRP-2 is coordinated.
- All three enyzmes are expressed in human epidermis. In melanocytes co-cultured with keratinocytes, these transcripts are expressed at a ratio of 45:45:10, respectively. In melanocytes cultured alone, only TRP-1 transcripts are present, indicating that a keratinocyte-derived signal is involved in the coordinate expression of these genes. The regulation of keratinocyte-melanocyte interactions and the mechanism of melanosome transfer into keratinocytes are not yet understood.
- the Protease-activated receptor-2 (PAR-2) is a seven transmembrane G-protein-coupled receptor, that is related to, but distinct from the thrombin receptors (TR, also named PAR-1, and PAR-3) in its sequence. Both receptors are activated proteolytically by an arginine-serine cleavage at the extracellular domain. The newly created N-termini then activate these receptors as tethered ligands. Both receptors could be activated by trypsin, but only the TRs are activated by thrombin. Only PAR-2 is activated by mast cell tryptase. Both receptors could also be activated by the peptides that correspond to their new N-termini, independent of receptor cleavage.
- SLIGRL the mouse PAR-2 activating peptide
- compositions of this invention may contain one or more compounds that act as trypsin, as tryptase, as serine protease or as PAR-2 agonists, for increase in pigmentation.
- they may contain one or more compounds that act as serine protease inhibitors, trypsin inhibitors, thrombin inhibitors, tryptase inhibitors, as PAR-2 pathway inhibitors or as a PAR-2 antagonist for decrease in pigmentation, or “depigmentation”.
- mammal means any member “of the higher vertebrate animals comprising the class “Mammalia”, as defined in Webster's Medical Desk Dictionary 407 (1986), and includes but is not limited to humans.
- receptor shall include both intracellullar and extracellular receptors and shall mean those molecules capable of receiving and transducing a signal.
- PAR-2 refers to the protease-activated receptor-2 or a related protease activated receptor.
- the Protease-activated receptor-2 (hereinafter, “PAR-2”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes and fibroblasts.
- the thrombin receptor also named PAR-1, hereinafter, “TR” is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes.
- the biological roles of PAR-2 and TR in skin are not entirely known. However, we have found that interactions between keratinocytes and melanocytes, via the PAR-2 pathway, affect melanogenesis.
- thrombin inhibitors, and/or tryptase inhibitors, and/or trypsin inhibitors and PAR antagonists can be used as depigmenting agents without irritation of the skin.
- PAR-2 agonists and serine proteases such as trypsin and tryptase can be used as darkening agents.
- PAR-2 could be useful as a target for whitening and darkening agents.
- FIG. 1A is a graph depicting the increase or decrease in relative pigmentation of epidermal equivalents containing melanocytes treated with known pigmenting and depigmenting agents in accordance with the methods of this invention.
- FIG. 1B is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
- FIG. 2 is a group of images of epidermal equivalents containing melanocytes treated with PAR-2 agonists and Compound I.
- FIG. 3 is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention.
- FIG. 4A is a graph depicting the dose/response with respect to pigmentation in epidermal equivalents containing melanocytes when treated with compositions of this invention.
- FIG. 4B is a graph depicting the response of epidermal equivalents containing melanocytes after exposure to ultraviolet light followed by treatment with compositions of this invention.
- FIG. 5A is a photograph depicting gels showing the expression of TR and PAR-2 in skin, melanoma cells and epidermal equivalents containing melanocytes.
- FIG. 5B is a photograph depicting gels showing the expression of TR and PAR-2 by primary human melanocytes.
- FIGS. 6A and 6B are photographs depicting gels showing the expression of various genes after treatment with different concentrations of Compound I and SLIGRL.
- FIG. 7 is a graph showing the effects of different compositions of this invention on the brightness of guinea pig nipple pigmentation.
- FIG. 8 is a photograph of Yucatan Swine skin which has been treated with compositions of this invention for depigmentation of skin.
- FIG. 9 is a graph depicting the brightness of Yucatan Swine skin during the course of treatment in accordance with the methods and compositions of this invention.
- FIGS. 10A , 10 B, 10 C and 10 D are photographs of F&M stained histological sections of Yucatan Swine skin treated with compositions containing Compound I in accordance with methods of this invention at concentrations of 0, 10 ⁇ M, 50 ⁇ M and 250 ⁇ M respectively.
- FIGS. 11A , 11 B and 11 C are photographs of electron micrographic views of epidermal equivalents containing melanocytes treated with compositions of this invention.
- FIGS. 11E , 11 F and 11 H are photographs of electron micrographic views of Yucatan Swine skin treated with compositions of this invention.
- FIGS. 11D and 11G are photographs of electron micrographic views of untreated sites of Yucatan Swine skin.
- FIGS. 12A , 12 B, 12 C, 12 D and 12 E are photographs of histological F&M stained sections of Yucatan Swine skin, as follows: 12 A shows untreated skin; 12 B shows skin treated with compositions of this invention after eight weeks of treatment; 12 C shows skin one week after stopping treatment; 12 D shows skin two weeks after stopping treatment and 12 E shows skin four weeks after stopping treatment.
- FIG. 13 is a photograph of F&M stained histological sections taken from Yucatan Swine skin treated with compositions of this invention.
- FIG. 14 contains ultraviolet and visible light digital photographs of human skin prior to treatment and subsequent to treatment with compositions of this invention.
- trypsin, tryptase and PAR-2 agonists can be used to increase pigmentation and that trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin.
- trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin.
- some of the compounds described in U.S. Pat. No. 5,523,308, which is hereby incorporated herein by reference, and behave as thrombin and/or trypsin and/or tryptase inhibitors will be useful in methods of this invention.
- A is selected from the group consisting of C 1-8 alkyl, carboxyC 1-4 alkyl,
- amino terminus of said amino acid is connected to a member selected form the group consisting of C 1-4 alkyl, tetrazol-5-yl-C 1-2 alkyl, carboxytC 1-4 alkyl, C 1-4 alkoxycarbonylC 1-4 alkyl, phenylC 1-4 alkyl, substituted phenyl C 1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C 1-4 alkyl, perfluoroC 1-4 alkyl, C 1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C 1-4 alkylamino, C 1-4 dialkylamino, carboy or C 1-4 alkoxycarbonyl), 1,1-diphenylC 1-4 alkyl, 3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]
- the first amino acid is a D or L amino acid, bound via its carboxy terminus tot he nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C 1-8 alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxylic acid, 5.5-dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC 3-8 alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C 1-4 alkoxy)proline, 4(C 1-4 alkoxy)proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, le
- p is 0 or 1;
- n is 0-3, R 3 is H or C 1-5 alkyl and the carbonyl moiety of B is bound to E;
- E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl, benzo[b]thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2-yl, naphtho[2,1-d]thiazol-2-yl, naphtho[1-2-d]thiazol-2-yl quinoxalin-2-yl, isoquinolin-1-yl, isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl, quinazol
- serine protease inhibitors may be extracted from the species belonging to the following plant families: Solanaceae (e.g., potato, tomato, tomatlla, and the like); Gramineae (e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like); Cucurbitaceae (e.g., cucumbers, squash, gourd, luffa and the like); and, preferably, Leguminosae (e.g., beans, peas, lentils, peanuts, and the like).
- Solanaceae e.g., potato, tomato, tomatlla, and the like
- Gramineae e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like
- Cucurbitaceae e.g., cucumbers, squash, gourd, luffa and the like
- Leguminosae e.g., beans, peas
- the compounds capable of affecting the pigmentation of the skin do so by interacting directly or indirectly with the keratinocyte PAR-2 or with its activating protease, and thereby affect melanogenesis, directly or indirectly.
- the compounds of this invention induce, in the case of increased pigmentation or reduce, in the case of decreased pigmentation, the signal to transport melanosomes by melanocytes, or to receive melanosomes by keratinocytes in the skin.
- the compounds which are active in the compositions and methods of this invention may be delivered topically by any means known to those of skill in the art. If the delivery parameters of the topically active pharmaceutical or cosmetic agent so require, the topically active composition of this invention may preferably be further composed of a pharmaceutically or cosmetically acceptable vehicle capable of functioning as a delivery system to enable the penetration of the topically active agent into the skin.
- One acceptable vehicle for topical delivery of some of the compositions of this invention may contain liposomes.
- the liposomes are more preferably none ionic and contain a) glycerol dilaurate (preferably in an amount of between about 5% and about 70% by weight); b) compounds having the steroid backbone found in cholesterol (preferably in an amount of between about 5% and about 45% by weight); and c) one or more fatty acid ethers having from about 12 to about 18 carbon atoms (preferably in an amount of between about 5% and about 70% by weight collectively), wherein the constituent compounds of the liposomes are preferably in a ratio of about 37.5:12.5:33.3:16.7.
- Liposomes comprised of glycerol dilaurate/cholesterol/polyoxyethylene-10-stearyl ether/polyoxyethylene-9-lauryl ether (GDL liposomes) are most preferred.
- the liposomes are present in an amount, based upon the total volume of the composition, of from about 10 mg/mL to about 100 mg/mL, and more preferably from about 20 mg/mL to about 50 mg/mL. A ratio of about 37.5:12.5:33.3:16.7 is most preferred.
- Suitable liposomes may preferably be prepared in accordance with the protocol set forth in Example 1, though other methods commonly used in the art are also acceptable.
- compositions of this invention may be prepared by combining the desired components in a suitable container and mixing them under ambient conditions in any conventional high shear mixing means well known in the art for non-ionic liposomes preparations, such as those disclosed in Niemiec et al., “Influence of Nonionic Liposomal composition On Topical Delivery of Peptide Drugs Into Pilosebacious units: An In Vivo Study Using the Hamster Ear Model,” 12 Pharm. Res. 1184-88 (1995) (“Niemiec”), which is incorporated by reference herein in its entirety. We have found that the presence of these liposomes in the compositions of this invention may enhance the depigmenting capabilities of some of the compositions of this invention.
- Other preferable formulations may contain, for example, soybean milk or other liquid formulations derived directly from legumes or other suitable plant.
- a formulation may contain a large proportion of soybean milk, an emulsifier that maintains the physical stability of the soybean milk, and, optionally a chelating agent, preservatives, emollients, humectants and/or thickeners or gelling agents.
- Oil-in-water emulsions, water-in-oil emulsions, solvent-based formulations and aqueous gels known to those of skill in the art may also be utilized as vehicles for the delivery of the compositions of this invention.
- the source of active compound to be formulated will generally depend upon the particular form of the compound. Small organic molecules and peptidyl fragments can be chemically synthesized and provided in a pure form suitable for pharmaceutical/cosmetic usage. Products of natural extracts can be purified according to techniques known in the art. Recombinant sources of compounds are also available to those of ordinary skill in the art.
- the topically active pharmaceutical or cosmetic composition may be optionally combined with other ingredients such as moisturizers, cosmetic adjuvants, anti-oxidants, bleaching agents, tyrosinase inhibitors and other known depigmentation agents, surfactants, foaming agents, conditioners, humectants, fragrances, viscosifiers, buffering agents, preservatives, sunscreens and the like.
- the compositions of this invention may also contain active amounts of retinoids (i.e., compounds that bind to any members of the family of retinoid receptors), including, for example, tretinoin, retinol, esters of tretinoin and/or retinol and the like.
- the topically active pharmaceutical or cosmetic composition should be applied in an amount effective to affect changes in the pigmentation of mammalian skin.
- amount effective shall mean an amount sufficient to cover the region of skin surface where a change in pigmentation is desired.
- the composition is liberally applied to the skin surface such that, based upon a square cm of skin surface, from about 2 ⁇ l/cm 2 to about 200 ⁇ l/cm 2 of topically active agent is present when a change in pigmentation is desired.
- a thrombin and trypsin inhibitor such as compound I or its analogs, whether synthetically- or naturally-derived in a formulation, such an active compound should be present in the amount of from about 0.0001% to about 15% by weight/volume of the composition.
- Liquid derivatives and natural extracts made directly from plants or botanical sources may be employed in the compositions of this invention in a concentration (w/v) from about 1 to about 99%.
- Fractions of natural extracts and naturally-derived protease inhibitors such as STI may have a different preferred range, from about 0.01% to about 20% and, more preferably, from about 1% to about 10% of the composition.
- mixtures of the active agents of this invention may be combined and used together in the same formulation, or in serial applications of different formulations.
- topically active agents such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors
- topically active agents such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors
- depigmenting agents are applied to the skin of a mammal at a relatively high concentration and dose (from about 0.005% to about 1% for compounds having high therapeutic indices such as Compound I and related compounds; from about 20% to about 99% for liquid derivatives and extracts of botanical materials; and from about 1% to about 20% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof) between one and two times daily for a period of time until the skin evidences a change in pigmentation. This may be for from about four to about ten weeks or more.
- a lower concentration and dose (from about 0.00001% to about 0.005% for compounds having high therapeutic indices such as Compound I and related compounds; from about 10% to about 90% for liquid derivatives and extracts of botanical materials; and from about 0.01% to about 5% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof), of active ingredient may be applied on a less frequent time schedule, e.g., about once per day to about twice per week.
- the effects of the active agents of this invention are reversible, therefore, in order to maintain these effects, continuous application or administration should be performed.
- the invention illustratively disclosed herein suitably may be practiced in the absence of any component, ingredient, or step which is not specifically disclosed herein.
- the epidermal equivalent system used contained melanocytes.
- One epidermal equivalent system which is useful in performing this study is the MelanoDerm system, available commercially from MatTek Co. This system contains human normal melanocytes, together with normal, human-derived epidermal keratinocytes, which have been cultured to form a multi layered, highly differentiated model of the human epidermis.
- equivalents were treated with test compounds for three days and samples were harvested on the fourth day after beginning of treatment.
- the harvested equivalents were stained with DOPA (a substrate for tyrosinase) and H&E (a standard histological stain) or with Fontana-Mason (F&M) staining, another stain known to those of skill in the art.
- F&M staining is a silver staining technique that clearly and cleanly marks melanins which have high silver nitrate reducing activity.
- Multilayered human epidermal equivalents containing melanocytes were used as an in vitro model system to study the effect of protease inhibitors on melanogenesis.
- Epidermal equivalents used were commercially available as MelanoDerm from MatTek of Ashland, Mass. These equivalents are known to respond to ultraviolet B (“UVB”) irradiation and known whitening agents such as benzaldehyde and hydroquinone by increasing and reducing pigmentation, respectively.
- UVB ultraviolet B
- the MelanoDerm epidermal equivalents were exposed to benzaldehyde (available from Sigma of St. Louis, Mo.), hydroquinone (available from Sigma) and UVB irradiation.
- UV irradiation was performed with a UVB FS light source in an exposure chamber, with plate covers removed and Phosphate-buffered saline (PBS, from Gibco-BRL, Gaithersburg, Md.) present in the lower chamber. UVB intensity was measured with a UVX radiometer (UVP Inc., San Gabriel, Calif.). Equivalents were treated with 0.1-0.12 J/cm 2 No loss of viability was observed in equivalents treated with up to 0.3 J/cm 2 .
- PBS Phosphate-buffered saline
- F&M identifies silver nitrate reducing molecules, which identifies primarily melanins. F&M stained sections were used for image analysis using Optomax Image Analysis Systems, from Optomax Inc., Hollis, N.H. Alternatively, Empire Images database 1.1 was used on a Gateway 2000 PS-100 computer (Media Cybernetics, Silver Springs, Md.) for capturing images. Image Pro Plus version 4.0 was used for image analysis. Parameters measured were as follows: (1) level of pigmentation within individual melanocytes and (2) number of pigmented melanocytes per field, for the Optomax system, or (1) the surface area of silver deposits within melanocytes and (2) the number of pigmented melanocytes for the Image Pro system.
- FIG. 1A is a graph depicting the increase or decrease in relative pigmentation, as measured and calculated by the whole equivalent/Image Pro system, as set forth above, when exposed to benzaldehyde (500M), hydroquinone (50 M) and UVB irradiation (0.12 J/cm 2 ).
- protease inhibitors were also exposed to mixtures of protease inhibitors, said protease inhibitors are set forth in Table A below.
- the protease inhibitors were available from Boehringer Mansheim of Indianapolis, Ind. Complete® Protease Inhibitor Cocktail tablets available from Boehringer Mannheim were used, containing inhibitors of chymotrypsin, thermolysin, papain, pronase, pancreatic extract and trypsin.
- Soybean trypsin inhibitor (“STI”) was available from Sigma and was dissolved in a 50 mg/ml liposome vehicle or in 1 ⁇ PBS. All other protease inhibitors used in this in vitro example were dissolved in 1 ⁇ PBS.
- GDL liposomes were prepared as set forth in Niemic, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van Dyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes.
- a Protease-Activated Receptor is Involved in Pigmentation
- Example 1 demonstrates that STI reduces pigmentation.
- STI inhibits trypsin. Because trypsin is known to activate TR and PAR-2, we tested the possible involvement of TR and PAR-2 in pigmentation.
- MelanoDerm human epidermal equivalents were treated with the TR and PAR-2 agonists and antagonists set forth in Table B below daily for three days. On the fourth day, the samples were harvested, fixed, and DOPA, H&E or F&M staining was performed. Histological and whole-equivalent examination revealed changes in pigmentation following the treatments.
- FIG. 2 depicts the results of this example. As shown therein, the PAR-2 peptide agonist SLIGRL induced pigmentation in individual melanocytes. Treatment with Compound I, an inhibitor of thrombin and trypsin, resulted in decreased pigmentation.
- FIG. 3 shows the results of the studies set forth in this example, representing the level of pigmentation in MelanoDerm equivalents treated with TR and PAR-2 reagents.
- SLIGRL a PAR-2 agonist
- Hirudin, a thrombin-specific inhibitor, and TFLLRNPNDK a TR selective agonist had no effect on pigmentation.
- SFLLRN a less specific TR agonists, showed a trend of lightening or reducing pigmentation. This indicates that TR is less likely to be involved in pigmentation.
- TR Trypsin Activates TR and PAR-2 TFLLRNPHDK TR peptide agonist - activates TR only SLIGRL PAR-2 peptide agonist - activates PAR-2 o SFLLRN TR peptide agonist - activates TR, cross-reacts with PAR-2 FSLLRN Scrambled peptide - inactive Hirudin Specific inhibitor of thrombin Compound I Thrombin and trypsin inhibitor
- PAR-2 and TR expression have been demonstrated previously in keratinocytes and fibroblasts. This example demonstrates that PAR-2 is expressed in keratinocytes, but not in melanocytes. Furthermore, it demonstrates that TR is expressed in both keratinocytes and melanocytes.
- RNA Stat-60 reagent available from “Tel-Test B”, Incorporated as described in Chomczymski, “Single Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-phenol-chloroform extraction,” 162 Anal. Biochem. 156-69 (1987).
- RNase-free DNase available from Promega Corporation under the tradename “RQ1 RNase-free DNase” was then added to the extracted RNA from each sample such that each respective product will yield 200 ng of DNased-RNA using the procedure set forth in “RNase-free DNase”, protocol published by Promega Corporation (May, 1995).
- the resulting 200 ng of DNased-RNA was reverse transcribed (“RT”) via the procedure set forth in “Superscript II Reverse Transcriptase” a protocol published by Gibco-BRL (now Life Technologies, Incorporated) (April 1992), using random hexamers such as the random primers which are commercially available from Life Technologies, Incorporated.
- RT products were then amplified via polymerase chain reaction (“PCR”) using about a 0.5 unit (per 100 ⁇ l reaction) of a thermostable DNA polymerase which is commercially available from Perkin-Elmer-Cetus Corporation under the tradename “Taq polymerase” and about 0.1 ⁇ mol/reaction of TR and PAR-2 specific primers as described in Table C and in Marthinuss et al., 1995 which is hereby incorporated herein by reference or of glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) primers, available from Clontech Laboratories, Inc. of Palo Alto, Calif. in accordance with the procedures set forth in Marthinuss et al., 1995 or in the protocol accompanying the primers from Clontech Laboratories.
- PCR polymerase chain reaction
- PCR products were then analyzed using 2% agarose/ethidium bromide gels according to methods well-known in the art in order to compare the level of expression of certain genes in keratinocytes and melanocytes. When necessary for better visualization, the resulting PCR products were precipitated with ethanol according to well-known procedures. When primers for G3PDH were used, only 10% of the PCR reaction products were used. An RNA sample from epidermal equivalents that was not reverse-transcribed was used as a negative control for each PCR amplification. The lack of genomic DNA contaminants was indicated by the lack of a band on the relevant lanes in the gels. A human skin RNA sample which was reverse-transcribed was used as a positive control when commercial positive controls were not available. The migration of the RT-PCR products on the gels was always identical to that of the positive controls, and to that of the reported amplimer sizes.
- FIG. 5A shows that, as expected, TR and PAR-2 are expressed in total skin and in the MelanoDerm equivalents (“MD”). However, S91 melanoma cells (“S91”) did not express PAR-2 or TR. To investigate this further, we tested primary newborn (“mel-NB”) and adult (“mel-A”) melanocytes for TR and PAR-2 expression. As shown in FIG. 5B , primary human melanocytes express TR but not PAR-2. Therefore, we suggest that PAR-2 agonists and antagonists can interact with keratinocytes, but not with melanocytes, in the MelanoDerm equivalents, and that TR agonists and antagonists could interact with both keratinocytes and melanocytes. A keratinocyte-melanocyte interaction is, therefore, suggested, during which the keratinocyte-PAR-2 signal is converted into a pigmentation end point.
- Table C illustrates some of the DNA primers used, the amount of MgCl 2 required for the PCR reaction, and the length of the PCR cycle.
- Example 4 suggest that melanocytes alone might not respond to the depigmenting effect of PAP-2 antagonists. Indeed, the level of pigmentation of human primary melanocytes or choleratoxin-induced S91 cells, which is reduced by hydroquinone and benzaldehyde, was not affected by Compound I.
- keratinocytes are indicated by “K”
- melanocytes are indicated by “M”
- lack of keratinocyte-melanocyte contact is indicated as “no K-M contact”.
- no effect on pigmentation was observed in primary melanocytes and in co-cultures treated with these agents.
- compound I reduced and SLIGRL induced pigmentation, while TFLLRNPNDK had no effect.
- RNAs extracted from untreated and Compound I-treated equivalents were analyzed for gene expression by RT-PCR in the manner set forth above in Example 4.
- Gene-specific primers were designed as set forth in Table C above, and Clontech primers for human G3PDH were used as in Example 4.
- Melanogenic genes tested for expression level were tyrosinase, TRP-1, and TRP-2.
- TRP-2 enzyme processes dopaquinone to 5,6-dihydroxyindole carboxylic acid (DHICA), rather than to 5,6-dihydroxyindole (DHI). This process results in brown, finely dispersed eumelanin, as opposed to insoluble black eumelanin, and results in a lighter skin tone.
- DHICA 5,6-dihydroxyindole carboxylic acid
- DHI 5,6-dihydroxyindole
- TRP-1 stabilizes the melanogenic complex, enabling pigment production.
- Reduced levels of TRP-1 result in reduced tyrosinase activity and reduced pigmentation. Lack of this protein results in albinism.
- Increasing concentrations of SLIGRL did not affect melanogenic gene expression ( FIG. 6B ).
- TRP-1 and TRP-2 are melanocyte-specific.
- Compound I inhibits trypsin and thrombin.
- Hirudin a specific thrombin inhibitor, had no effect on pigmentation, as seen above in Example 2.
- a probe designed to detect both brain and gastric trypsins as described in Table C, detected the expression of both mRNAs in a total skin mRNA sample available from Invitrogen of Carlsbad, Calif., as well as in MelanoDerm equivalents. The same expression pattern was detected for thrombin. Both trypsin and thrombin were not expressed in normal melanocytes ( FIGS. 5A , B).
- Two guinea pigs were treated twice daily, five days/week for seven weeks with Compound I at 1 and 10 ⁇ M in 70:30 ethanol:propylene glycol vehicle on one pigmented nipple.
- the other nipple of each animal was treated with vehicle only and served as a control.
- Chromameter measurement after seven weeks of treatment revealed a dose-dependent lightening effect of +9.6 L* and nearly 18 L* units respectively. No visible signs of irritation were observed at that time.
- a Yucatan mitroswine was treated with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 ⁇ M. Each compound was applied to two sites on the pig twice daily, five days per week for eight weeks. After eight weeks of treatment, chromameter measurements were taken. The application of Compound T resulted in a visible lightening effect. The PAR-2 agonist SLIGRL resulted in a darkening effect as measured by chromameter. SFLLRN and FSLLRN had no significant effects.
- Two Yucatan swine were treated for seven and a half weeks, or for ten weeks, twice daily, five days per week, with increasing concentrations of Compound I.
- Four concentrations of active compound were used, as follows: 0, 10, 50 and 250 ⁇ M.
- Two sites per concentration were placed on opposite sides of the swine dorsum. Chromameter measurements were taken before treatment started and every two weeks thereafter. Pictures were taken periodically and at the end of the experiment. A visible lightening effect was observed during the 4th, 5th and 6th weeks of treatment, for the 250, 50 and 10 ⁇ M treatments, respectively.
- the eighth week the whitening effect of the two highest doses was similar.
- the chromameter readings (L*, measuring brightness) during the treatment course of one swine are shown in FIG. 9 .
- a saturation effect is observed, which is a time and concentration dependent.
- This example demonstrates a visual depigmenting effect by Compound I, in the animal model system most resemble pigmented human skin.
- a Yucatan swine was treated with Compound 1,250-M, for eight weeks, twice daily, five days a week, on eight sites. All sites showed visible depigmentation by the end of the treatment period, as set forth in FIG. 12B .
- the color of the treated sites was monitored, and two biopsies were taken each week from two treated sites. Untreated sites were biopsied as well. The depigmenting effect could be visualized at one and two weeks post treatment, and a complete reversal was observed by the forth week. Histological examination of F&M stained skin sections confirmed the repigmentation observed visually (as indicated in FIG. 12 ).
- FIG. 12A shows two histological F&M stained sections of sites which were not treated with Compound I.
- FIG. 12B shows two histological F&M stained sections of sites which were treated with Compound I for eight weeks.
- FIG. 12C shows sections of sites which were treated for eight weeks with Compound I, one week after treatment was stopped.
- FIG. 12D shows sections of sites which were treated for eight weeks with Compound I, two weeks after treatment was stopped.
- FIG. 123 shows sections of sites which were treated for eight weeks with Compound I, four weeks after treatment was stopped.
- the sections were fully repigmented four weeks after the end of treatment.
- Example 1 demonstrates that the presence of soybean trypsin inhibitor in any lightening formulation is desirable for its depigmenting activity. Based on analytical testing, it has been determined that soybean milk and soybean paste are rich sources of soybean trypsin inhibitor.
- soybeans were first soaked in deionized or purified water for several hours. The soybeans were ground after they were fully hydrated, with the addition of small quantities of water, if needed, to smoothen the paste. To make soybean milk, the same procedure was performed with the addition of more water. (The grinding process allows the soybean milk to be extracted). After collection, the soybean milk was filtered to remove any residual parts of the bean husk.
- Soybean milk, soybean paste and miso were prepared to be used as naturally-derived materials that contain STI and are able to lighten skin color.
- Two Yucatan swine were treated for eight and ten weeks, twice a day, five days a week, with different soybean- and lima-bean-derived products.
- These natural products include soybean paste, soybean protein acid hydrolysate, misc, native and boiled soybean milk, and a commercially available extract of soybean (Actiphyte® of Active Organics, Dallas Tex.), as well as purified STI, and different preparations of trypsin inhibitors from soybeans and limabeans.
- Actiphyte® of Active Organics, Dallas Tex. a commercially available extract of soybean
- STI purified STI
- An STI in Liposome Formulation can Lighten Human Age Spots
- An individual with three age spots on the dorsum of their hand was treated for eight weeks, twice a day, with the following:
- the age spot located closest to the arm was treated with placebo, containing 20 mg/ml of liposomes.
- the middle age spot was not treated.
- the third age spot was treated with STI, 1%, in liposomes (20 mg/ml).
- GDL liposomes were prepared as set forth in Niemiec, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van tyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. UV and visible light digital pictures were taken at time 0, 4 and 8 weeks of treatment. L* (brightness) values were calculated from the images using Adobe Photoshop.
- FIG. 14 is a composite of four pictures.
- the left panel is the visible light pictures of the hand, before (upper) and after (lower) 8 weeks of treatment.
- the top age spot is the placebo-treated
- the middle age spot is untreated
- the lower age spot is the STI-treated.
- the right panel shows the same hand at the same time points, using UV-photography. UV light enables the visualization of pigment deeper in the skin, demonstrating that the STI whitening effect was not superficial.
- FIG. 14 clearly demonstrates that the STI formulation was able to lighten the lower age-spot. An increase of 15 L* units was calculated for this STI-treated site, further demonstrating the ability of this treatment to lighten age spots.
- soybean milk In making the soybean milk, it was discovered that the rich emolliency of the milk would be desirable in a skin care formulation. Because water is used as the predominant ingredient of any oil-in-water emulsion, and in many other skin-care formulations we hypothesized that the soymilk could be used to substitute for the deionized water in such formulations. However, we expected that this type of formulation would not be physically stable due to the immiscibility of the oil and water components of the soybean milk. Surprisingly, we found that this substitution of soybean milk for water was physically stable. Formulations utilizing soybean milk should contain between about 1% and about 99% of soybean milk, more preferably from about 80% to about 95% soybean milk.
- this and similar formulations should include a viscosity builder in an amount from about 0% to about 5% (more preferably, from about 0.1 to about 2%), one or more emollients in an amount up to about 20% and/or emulsifiers in an amount from about 0.1% to about 10% (more preferably from about 3 to about 5%), and, optionally, a spreading agent in an amount from about 0 to about 5% (more preferably from about 1 to about 2%), a preservative, a chelating agent or a humectant.
- the preservative should be present in an effective amount in order to preserve integrity of the milk and maintain the composition's activity.
- Sufficient thickener should be present to impart body to the formulation without causing it to become so viscous that it would hinder spreadability, e.g., from about 0 to about 10%, more preferably from about 3 to about 5%.
- Sunscreen, antioxidants, vitamins other depigmenting agents and other skin care topical ingredients may also be incorporated into the compositions of this invention.
- STI soybean paste and other trypsin inhibitor-containing natural extracts can be incorporated into such formulations to provide increasing concentrations of the serine protease inhibitor.
- Use levels of the added active ingredient can range between 0.01% to 15% in a formulation.
- Other depigmenting agents including PAR-2 inhibitors, tyrosinase inhibitors, hydroquinones, soy products, ascorbic acid and its derivatives, as well as other ingredients with skin care benefits could also be incorporated into this formulation.
- Table F Two examples of a depigmenting formulation with oil-in-water emulsion are presented in Table F.
- a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table F.
- a similar formulation with Compound I is presented in column 5 of Table F.
- Compound I in this composition could be replaced with similar compounds, or with serine protease inhibitors or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table F.
- the deionized water content of these formulations could be replaced with soybean milk.
- the ingredients of the lipid phase were combined and mixed at 85° C., and then cooled to 60° C.
- the carbopol was slowly added to the water or to the soybean milk. After mixing for ten minutes the rest of the aqueous phase ingredients were added and the mix was heated to 60° C. The two phases were then combined, mixed for ten minutes, and cooled to room temperature.
- one or more depigmentation agents may be combined within the same formulation, in this Example and in the following examples and other embodiments of the methods and compositions of this invention.
- Table G Two additional examples of an oil-in-water emulsion depigmenting formulation are presented in Table G.
- a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 3 of Table G.
- a similar formulation with Compound I is presented in column 4 of Table G.
- Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table G.
- the deionized water content of these formulations could be replaced with soybean milk.
- the hydroxyethylcellulose was slowly added to the water or to the soybean milk and stir until completely dissolved.
- the Acrylates/C10-30 Alkyl Acrylate Crosspolymer was added and stir until completely dissolved.
- the content of the two containers was combined and mixed for 20 minutes Vitamin E acetate was then added and mixed, following by the addition of Isohexadecane and Panthenol (98%).
- the STI, or the natural extract, or Compound I were added together with Propylene Glycol, and stirred for 5 minutes.
- glycerine was added and the formulation was stirred for 20 minutes.
- the pH was adjusted with sodium hydroxide to 8 for STI (range is 6-8.5) or to 7 for Compound I (range is 5.5-8.5).
- Table H An example of a depigmenting formulation with water-in-oil emulsion is presented in Table H.
- a formulation with STI where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in column 4 of Table H.
- a similar formulation with Compound I is presented in column 5 of Table H.
- Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table H.
- the deionized water content of these formulations could be replaced with soybean milk.
- Table J Two examples of a depigmenting formulation with aqueous gel are presented in Table J.
- a similar formulation with Compound I is presented in column 4 of Table J.
- Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table J.
- the deionized water content of these formulations could be replaced with soybean milk.
- Disodium EDTA, sodium metabisulfite and ascorbic acid were slowly added to the water or to the soybean milk and stir until completely dissolved.
- STI, natural extracts or Compound I were then added and mixed slowly for five minutes. The speed of agitation was then increased and carbopol was added.
- the composition was mixed for 30 minutes or until the dispersion was free of “fish eyes”, which are non-dispersed clear lumps, and heated to 50° C.
- the slurry phase was prepared by combining Octoxynol-13,2,4-Hexadienoic acid, and Benzenemethanol and stirring ten minutes at 40-50° C.
- the slurry was then added slowly to the aqueous phase, mixed, and cooled to 45° C. 20% sodium hydroxide solution was used to pH the composition to pH of 7.0 (range is 5.5-8.5). This was mixed to homogeneity using agitation or sweep vessel.
- Table K An example of a depigmenting formulation containing solvent is presented in Table K.
- a similar formulation with Compound I is presented in column 4 of Table K.
- Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table K.
- the deionized water content of these formulations could be replaced with soybean milk
- activation of the keratinocyte receptor PAR-2 results in increased pigmentation.
- activation may be accomplished by the use of trypsin or SLIGRL or SLIKOKVD or other SLTGRL or SLIGKVD derivatives.
- whitening may be accomplished by the use of serine protease inhibitors or PAR-2 antagonists, as well as by melanosome-transfer blockers.
- Other compounds known to those of skill in the art that inhibit melanosome transfer into keratinocytes could also be used as depigmenting agents.
- Compound I a trypsin and thrombin inhibitor, for example, inhibits melanosome transfer to keratinocytes.
- STI works by the same mechanism, The accumulation of undelivered melanosomes in the melanocytes could induce a negative feed back mechanism, that slows new melanosome formation.
- the production of TRP-1 the major glycoprotein in melanocytes, is down-regulated, which leads to destabilization of tyrosinase. This results in reduced melanin formation, and in a color switch to a lighter brown, as the ratio of TRP-1:TRP-2 is reduced.
- the melanosomes accumulation in the melanocyte after Compound I treatment, or after STI treatment therefore, have reduced and altered melanin content, which adds to the whitening effect of compound I or STI.
Abstract
This invention relates to methods and compositions for bringing about changes in skin pigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin utilizing the PAR-2 pathway.
Description
- This invention is related to methods and compositions for bringing about skin pigmentation and/or for causing skin depigmentation. More particularly, this invention relates to compounds which affect melanogenesis and can be used as depigmenting agents or as agents for darkening skin.
- Skin coloring has been of concern to human beings for many years. In particular, the ability to remove hyperpigmentation, such as found in age spots, freckles or aging skin generally, is of interest to individuals desiring a uniform complexion. In certain areas of the world, general body whitening is desirable. There are also hypopigmentation and hyperpigmentation disorders that are desirable to treat. Likewise, the ability to generate a tanned appearance without incurring photodamage due to solar radiation is important to many individuals. There have been many methods proposed to accomplish depigmentation, as well as to accomplish darkening of the skin. For example, kojic acid, hydroguinone, retinoids and other chemical compounds have been used for depigmentation. Dihydroxyacetone and like chemical compounds have been utilized for their ability to “tan” the skin without exposure to the sun.
- Many of these previous solutions have not been found acceptable. There is often a distinct line of demarcation between the areas of skin to which such previous compositions have been applied. Therefore, precise application of all these compounds is necessary in order to achieve the desired result. Many of these compounds have been found to be quite irritating to the skin and therefore undesirable for use.
- The understanding of the chemical and enzymatic basis of melanogenesis is heavily documented. Melanocytes migrate from the embryonal neural crest into the skin to produce secretory granules, melanosomes, which produce melanin. Melanogenesis occurs within the melanosome, and the melanin is later distributed to keratinocytes via the melanocyte dendrites. The key enzyme in melanogenesis is tyrosinase, which initiates a cascade of reactions which convert tyrosine to the biopolymer melanin. Two tyrosinase-related proteins (TRP's) are known, TRP-1 and TRP-2. These proteins share with tyrosinase about 40% homology and have catalytic activities as well as regulatory roles in melanogenesis. TRP-1 is the most abundant glycoprotein in melanocytes.
- In spite of the fact that the chemical and enzymatic basis of melanogenesis is well-documented, its regulation at the cellular level is only partially understood. Tyrosinase and the TRP's share structural and biological properties with the lysosomal-associated membrane protein (LAMP) gene family, therefore their targeting to the melanosomal membrane might induce their activation. A phosphorylation/dephosphorylation reaction at the cytoplasmic tails of these proteins could be involved in the regulation of melanogenesis. The beta isoform of the Protein Kinase C(PKC) family has been shown to regulate human melonogenesis through tyrosinase activation. Gene expression of tyrosinase, TRP-1 and TRP-2 is coordinated. All three enyzmes are expressed in human epidermis. In melanocytes co-cultured with keratinocytes, these transcripts are expressed at a ratio of 45:45:10, respectively. In melanocytes cultured alone, only TRP-1 transcripts are present, indicating that a keratinocyte-derived signal is involved in the coordinate expression of these genes. The regulation of keratinocyte-melanocyte interactions and the mechanism of melanosome transfer into keratinocytes are not yet understood.
- The Protease-activated receptor-2 (PAR-2) is a seven transmembrane G-protein-coupled receptor, that is related to, but distinct from the thrombin receptors (TR, also named PAR-1, and PAR-3) in its sequence. Both receptors are activated proteolytically by an arginine-serine cleavage at the extracellular domain. The newly created N-termini then activate these receptors as tethered ligands. Both receptors could be activated by trypsin, but only the TRs are activated by thrombin. Only PAR-2 is activated by mast cell tryptase. Both receptors could also be activated by the peptides that correspond to their new N-termini, independent of receptor cleavage. SLIGRL, the mouse PAR-2 activating peptide, is equipotent in the activation of the human receptor. While the function of the TR is well documented, the biology of the PAR-2 has not yet been fully identified. A role for PAR-2 activation in the inhibition of keratinocyte growth and differentiation has been recently described (Derian et al., “Differential Regulation of Human Keratinocyte Growth and Differentiation by a Novel Family of Protease-activate Receptors”, Cell Growth & Differentiation, Vol. 8, pp. 743-749, July 1997).
- In accordance with this invention, we have found a method for affecting changes in mammalian skin pigmentation comprising topically applying to the skin of a mammal a compound which affects the PAR-2 pathway. The compositions of this invention may contain one or more compounds that act as trypsin, as tryptase, as serine protease or as PAR-2 agonists, for increase in pigmentation. Alternatively, they may contain one or more compounds that act as serine protease inhibitors, trypsin inhibitors, thrombin inhibitors, tryptase inhibitors, as PAR-2 pathway inhibitors or as a PAR-2 antagonist for decrease in pigmentation, or “depigmentation”.
- As used herein, “mammal” means any member “of the higher vertebrate animals comprising the class “Mammalia”, as defined in Webster's Medical Desk Dictionary 407 (1986), and includes but is not limited to humans. As used herein, “receptor” shall include both intracellullar and extracellular receptors and shall mean those molecules capable of receiving and transducing a signal. The term PAR-2 refers to the protease-activated receptor-2 or a related protease activated receptor.
- The Protease-activated receptor-2 (hereinafter, “PAR-2”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes and fibroblasts. The thrombin receptor (also named PAR-1, hereinafter, “TR”) is a serine-protease activated receptor that is expressed in numerous tissues, including keratinocytes. The biological roles of PAR-2 and TR in skin are not entirely known. However, we have found that interactions between keratinocytes and melanocytes, via the PAR-2 pathway, affect melanogenesis. We have found that thrombin inhibitors, and/or tryptase inhibitors, and/or trypsin inhibitors and PAR antagonists can be used as depigmenting agents without irritation of the skin. PAR-2 agonists and serine proteases such as trypsin and tryptase can be used as darkening agents. Furthermore, PAR-2 could be useful as a target for whitening and darkening agents.
-
FIG. 1A is a graph depicting the increase or decrease in relative pigmentation of epidermal equivalents containing melanocytes treated with known pigmenting and depigmenting agents in accordance with the methods of this invention. -
FIG. 1B is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention. -
FIG. 2 is a group of images of epidermal equivalents containing melanocytes treated with PAR-2 agonists and Compound I. -
FIG. 3 is a graph depicting the increase or decrease in relative pigmentation in epidermal equivalents containing melanocytes treated in accordance with the methods and compositions of this invention. -
FIG. 4A is a graph depicting the dose/response with respect to pigmentation in epidermal equivalents containing melanocytes when treated with compositions of this invention. -
FIG. 4B is a graph depicting the response of epidermal equivalents containing melanocytes after exposure to ultraviolet light followed by treatment with compositions of this invention. -
FIG. 5A is a photograph depicting gels showing the expression of TR and PAR-2 in skin, melanoma cells and epidermal equivalents containing melanocytes. -
FIG. 5B is a photograph depicting gels showing the expression of TR and PAR-2 by primary human melanocytes. -
FIGS. 6A and 6B are photographs depicting gels showing the expression of various genes after treatment with different concentrations of Compound I and SLIGRL. -
FIG. 7 is a graph showing the effects of different compositions of this invention on the brightness of guinea pig nipple pigmentation. -
FIG. 8 is a photograph of Yucatan Swine skin which has been treated with compositions of this invention for depigmentation of skin. -
FIG. 9 is a graph depicting the brightness of Yucatan Swine skin during the course of treatment in accordance with the methods and compositions of this invention. -
FIGS. 10A , 10B, 10C and 10D are photographs of F&M stained histological sections of Yucatan Swine skin treated with compositions containing Compound I in accordance with methods of this invention at concentrations of 0, 10 μM, 50 μM and 250 μM respectively. -
FIGS. 11A , 11B and 11C are photographs of electron micrographic views of epidermal equivalents containing melanocytes treated with compositions of this invention. -
FIGS. 11E , 11F and 11H are photographs of electron micrographic views of Yucatan Swine skin treated with compositions of this invention. -
FIGS. 11D and 11G are photographs of electron micrographic views of untreated sites of Yucatan Swine skin. -
FIGS. 12A , 12B, 12C, 12D and 12E are photographs of histological F&M stained sections of Yucatan Swine skin, as follows: 12A shows untreated skin; 12B shows skin treated with compositions of this invention after eight weeks of treatment; 12C shows skin one week after stopping treatment; 12D shows skin two weeks after stopping treatment and 12E shows skin four weeks after stopping treatment. -
FIG. 13 is a photograph of F&M stained histological sections taken from Yucatan Swine skin treated with compositions of this invention. -
FIG. 14 contains ultraviolet and visible light digital photographs of human skin prior to treatment and subsequent to treatment with compositions of this invention. - We have discovered that trypsin, tryptase and PAR-2 agonists can be used to increase pigmentation and that trypsin inhibitors, and/or tryptase inhibitors, and/or thrombin inhibitors and PAR-2 antagonists act to decrease pigmentation in mammalian skin. In our opinion, some of the compounds described in U.S. Pat. No. 5,523,308, which is hereby incorporated herein by reference, and behave as thrombin and/or trypsin and/or tryptase inhibitors, will be useful in methods of this invention. Some of these compounds are also described in Costanzo, et al., “Potent Thrombin Inhibitors That Probe the S1′ Subsite: Tripeptide Transition State Analogues Based on a Heterocycle-Activated Carbonyl Group”, J. Med. Chem., 1996, Vol. 39, pp. 3039-3043 and have the following structural formula:
- wherein:
- A is selected from the group consisting of C1-8alkyl, carboxyC1-4alkyl,
- C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents are independently selected from one or more of, C1-4 alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), formyl, C1-4alkoxycarbonyl,
C1-2alkylcarbonyl, phenylC1-4alkoxycarbonyl, C3-7cycloakylcarbonyl, phenylcarbonyl, substituted phenylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), C1-4alkylsulfonyl, C1-4alkoxysulfonyl, perfluoroC1-4alkyl-sulfonyl, phenylsulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenylC1-4alkysulfonyl, C1-4alkylsulfinyl, perfluoroC1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), phenylC1-4alkylsulfinyl, substituted pehnylC1-4alkylsulfinyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl or substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, carboxy or C1-4alkoxyy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl or substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); a D or L amino acid which is coupled as its carboxy terminus to the nitrogen depicted in formula I and is selected from the group consisting of alanine, asparagine, 2-azetidinecarboxylic acid, glycine, N—C1-8alkyglycine, proline, 1-amino-1-cycloC3-8alkylcarboxylic acid, thiazzolidine-4-carboxylic acid, 5,5-dimethylthiazolidine-4-carboxylic acid, oxadolidine-4-carboxylic acid, pipecolinic acid, valine, methionine, cysteine, serine, threonine, norleucine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalamine, 2-thienylalanine, 3-thienylalanine, [1,2,3,4]-tetrahydroisoquinoline-1-carboxylic acid and 1,2,3,4,]-tetrahydroisoquinoline-2-caroboxylic acid - where the amino terminus of said amino acid is connected to a member selected form the group consisting of C1-4alkyl, tetrazol-5-yl-C1-2alkyl, carboxytC1-4alkyl, C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenyl C1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1,1-diphenylC1-4alkyl, 3-phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyethylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]-tetrahydroisoquinoline-3, carbonyl, 1-methylamino-1-cyclohexanecarbonyl, 1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl, 1-cyclohexyl-1-hydroxyacetyl, 3-phenyl-2-hydroxypropionyl, 3,3-diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl, formyl, C1-4alkoxycarbonyl, C1-12alkylcarbonyl, perfluoroC1-4alkyl, C1-4alkylcarbonyl, phenylC1-4alkylcarbonl, substituted phenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl) 1,1-diphenylC1-4alkylcarbonyl, substituted 1,1-diphenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxy-carbonyl), perfluoroC1-4alkysulfonyl, C1-4alkysulfonyl, C1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C-1alkyl, perfluoro C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 10-cxamphorsulfonyl, phenylC1-4alkylsulfonyl, substituted phenylC1-4alkylsulfonyl, perfluoroC1-4alkysulfinyl, C-14alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4 alkylamino, C1-4 dialkylamino, carboxy or C1-4 alkoxycarbonyl), 1-naphthysulfonl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1-naphthysulfinyl, 2-naphthysulfinyl, and substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C104dialkylamono, carboxy or C-14alkoxycarbonyl): or a poly peptide comprised of two amino acids,
- where the first amino acid is a D or L amino acid, bound via its carboxy terminus tot he nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C1-8alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxylic acid, 5.5-dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC3-8 alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C1-4alkoxy)proline, 4(C1-4alkoxy)proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2.2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalanine, 2-thienylalanine, 3-thienylalnine, [1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic acid-4-C1-4alkyl ester and glutamic acid 5-C1-4alkyl ester and the second D or L amino acid, is bound to the amino terminus of said first amino acid, and is selected from the group consisting of phenylalanine, 4-benzolyphenylalanine, 4-carboxyphenylalanine, 4-(Carboxy C1-2alkyl)phenylalanine, substituted phenylalanine (where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 3-benzothienylalanine, 4-biphenylalanine, homophenylalanine, octahydroindole-2-carboxylic acid, 2-pyridylalanine, 3-pyridylalanine, 4-thiazolyalanine, 2-thienylalanie, 3-(3-benzothienyl)alanine, 3-thienylalanine, tryptophan, tyrosine, asparagine, 3-tri-C1-4alkylsilylalanine, cyclohexylglycine, diphenylglycine, phenylglycine, methionine sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine, 2-(1-naphthylalanine), 2-(2-naphthylalanine), phenyl substituted phenylalanine (where the substituents are selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialylamino, carboxy or C1-4 alkoxycarbonyl), aspartic acid, aspartic acid-4C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbony), aspartic acid, aspartic acid-4-C1-4alkyl ester glutamic acid, glutamic acid-5-C1-4 alkyl ester, cycloC3-salkylaalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4 alkyl ester, cycloC3-salkylalanine, substituted cycloC3-aalkylalanine (where the ring substituents are carboxy, C1-4alkylcarboxy, C1-4alkoxycarbonyl or aminocarbonyl), 2,2-diphenylalanine and all alpha-C1-alkyl of all amino acid derivatives thereof, where the amino terminus of said second amino acid is unsubstituted or monosubstituted with a member of the group consisting of formyl, C1-12 alkyl, tetrazol-5-ylC1-2alkyl, carboxyC1-8 alkyl, carboalkoxyC1-4alkyl, phenyl C1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents or independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-dipehnylC1-4alkyl, C1-6alkoxycarbonyl, phenylC1-6alkoxycarbonyl, C1-2alkylcarbonyl, perfluoroC1-4alkylC1-4alkylcarbonyl, phenyC1-4alkylcarbonyl, substituted phenyC1-4alkylcarbonyl(where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-diphenylC1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenylC1-4alkylsulfonyl, C1-4alkysulfinyl, perfluoro C1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamono, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl), phenyC1-4alkylsulfinyl, substituted phenylC1-4alkylsulfinyl 1-naphthylsulfonyl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituent is selected from C1-4alkyl; pertluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1-haphthyl-sulfinyl, 2-haphthylsulfinyl and substituted naphthyl-sulfinyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-14alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C-14dialkylamino, carboxy or C1-4alkoxycarbonyl); R1 is selected from the group consisting of hydrogen and alkyl; R2 is selected from the group consisting of aminoC2-salkyl, guanidinoC2-5alkyl, C1-4alkylguanidinoC2-5alkyl, diC1-4alkylguanidinoC2-5alkyl, amidinoC2-5alkyl, C1-4alky-lamidinoC2-5alkyl, diC1-4alky-1amidinoC2-5alkyl, C1-3 alkoxyC2-5alkyl, phenyl, substituted phenyl (where the substituents are independently selected from one or more of amino, amidino, guanidino, C1-4alkylamino, C1-4dialkylamino, halogen, perfluoro C1-4alkyl, C1-4alkyl, C1-3 alkoxy or nitro), benzyl, phenyl substituted benzyl (where the substituents are independently selected from one or more of, amino, amidino, guanidino, C1-4alkylamino, C1-4dialky-lamino, halogen, perfluoro C1-4alkyl, C1-04alkyl, C1-3alkoxy or nitro); hydroxyC2-5alkl, C′1-5alkylaminoC2-5alkyl, C1-5dialkylaminoC2-5alkyl, 4-aminocyclohexylC0-2alkyl and C1-5alkyl;
- p is 0 or 1;
- B is
- where n is 0-3, R3 is H or C1-5alkyl and the carbonyl moiety of B is bound to E;
- E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl, thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2-quinoxalin-2yl, 2-pyridyl, 3-pyridyl, benzo[b]thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2-yl, naphtho[2,1-d]thiazol-2-yl, naphtho[1-2-d]thiazol-2-yl quinoxalin-2-yl, isoquinolin-1-yl, isoquinolin-3-yl, benzo[b]furan-2-yl, [pyrazin-2-yl, quinazolin-2 yl, isothiazol-5-yl, isothiazol-3-yl, purin-8yul and a substituted heterocycle where the substituents are selected from C14 from C-14alky, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy, C1-4alkoxycarbonyl, hydroxy or phenylC1-4 alkylaminocarbonyl;
- or pharmaceutically acceptable salts thereof.
- More particularly, in our opinion, some of the compounds of the foregoing formula containing a d-phenylalanine-proline-arginine motif should be effective in inhibiting the PAR-2 pathway and causing depigmentation. One particularly preferred compound which acts as a thrombin and trypsin inhibitor and is active in depigmenting mammalian skin is (S)—N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)amino]-1-(2-benzothiazolylcarbonyl)butyl]-L-prolinamide (Chemical Abstracts name) (hereinafter referred to as “Compound I”). We suggest that other compounds which are analogs or function similarly to Compound I and are set forth in U.S. Pat. No. 5,523,308 may be active in the methods and compositions of this invention. Other compounds that inhibit trypsin, such as serine protease inhibitors, and in particular, soybean trypsin inhibitor (STI) will also be useful in methods of this invention. Soybean, limabean and blackbean extracts, and other natural products made from these beans, such as, but not limited to, bean milk, bean paste, miso and the like, also serve to reduce pigmentation by this mechanism.
- Additional sources of serine protease inhibitors may be extracted from the species belonging to the following plant families: Solanaceae (e.g., potato, tomato, tomatlla, and the like); Gramineae (e.g., rice, buckwheat, sorghum, wheat, barley, oats and the like); Cucurbitaceae (e.g., cucumbers, squash, gourd, luffa and the like); and, preferably, Leguminosae (e.g., beans, peas, lentils, peanuts, and the like).
- While not willing to be bound by the following theory, we theorize that the compounds capable of affecting the pigmentation of the skin do so by interacting directly or indirectly with the keratinocyte PAR-2 or with its activating protease, and thereby affect melanogenesis, directly or indirectly. Possibly, the compounds of this invention induce, in the case of increased pigmentation or reduce, in the case of decreased pigmentation, the signal to transport melanosomes by melanocytes, or to receive melanosomes by keratinocytes in the skin.
- The compounds which are active in the compositions and methods of this invention may be delivered topically by any means known to those of skill in the art. If the delivery parameters of the topically active pharmaceutical or cosmetic agent so require, the topically active composition of this invention may preferably be further composed of a pharmaceutically or cosmetically acceptable vehicle capable of functioning as a delivery system to enable the penetration of the topically active agent into the skin.
- One acceptable vehicle for topical delivery of some of the compositions of this invention, particularly proteins such as trypsin and STI, may contain liposomes. The liposomes are more preferably none ionic and contain a) glycerol dilaurate (preferably in an amount of between about 5% and about 70% by weight); b) compounds having the steroid backbone found in cholesterol (preferably in an amount of between about 5% and about 45% by weight); and c) one or more fatty acid ethers having from about 12 to about 18 carbon atoms (preferably in an amount of between about 5% and about 70% by weight collectively), wherein the constituent compounds of the liposomes are preferably in a ratio of about 37.5:12.5:33.3:16.7. Liposomes comprised of glycerol dilaurate/cholesterol/polyoxyethylene-10-stearyl ether/polyoxyethylene-9-lauryl ether (GDL liposomes) are most preferred. Preferably the liposomes are present in an amount, based upon the total volume of the composition, of from about 10 mg/mL to about 100 mg/mL, and more preferably from about 20 mg/mL to about 50 mg/mL. A ratio of about 37.5:12.5:33.3:16.7 is most preferred. Suitable liposomes may preferably be prepared in accordance with the protocol set forth in Example 1, though other methods commonly used in the art are also acceptable. The above described composition may be prepared by combining the desired components in a suitable container and mixing them under ambient conditions in any conventional high shear mixing means well known in the art for non-ionic liposomes preparations, such as those disclosed in Niemiec et al., “Influence of Nonionic Liposomal composition On Topical Delivery of Peptide Drugs Into Pilosebacious units: An In Vivo Study Using the Hamster Ear Model,” 12 Pharm. Res. 1184-88 (1995) (“Niemiec”), which is incorporated by reference herein in its entirety. We have found that the presence of these liposomes in the compositions of this invention may enhance the depigmenting capabilities of some of the compositions of this invention.
- Other preferable formulations may contain, for example, soybean milk or other liquid formulations derived directly from legumes or other suitable plant. For example, such a formulation may contain a large proportion of soybean milk, an emulsifier that maintains the physical stability of the soybean milk, and, optionally a chelating agent, preservatives, emollients, humectants and/or thickeners or gelling agents.
- Oil-in-water emulsions, water-in-oil emulsions, solvent-based formulations and aqueous gels known to those of skill in the art may also be utilized as vehicles for the delivery of the compositions of this invention.
- The source of active compound to be formulated will generally depend upon the particular form of the compound. Small organic molecules and peptidyl fragments can be chemically synthesized and provided in a pure form suitable for pharmaceutical/cosmetic usage. Products of natural extracts can be purified according to techniques known in the art. Recombinant sources of compounds are also available to those of ordinary skill in the art.
- In alternative embodiments, the topically active pharmaceutical or cosmetic composition may be optionally combined with other ingredients such as moisturizers, cosmetic adjuvants, anti-oxidants, bleaching agents, tyrosinase inhibitors and other known depigmentation agents, surfactants, foaming agents, conditioners, humectants, fragrances, viscosifiers, buffering agents, preservatives, sunscreens and the like. The compositions of this invention may also contain active amounts of retinoids (i.e., compounds that bind to any members of the family of retinoid receptors), including, for example, tretinoin, retinol, esters of tretinoin and/or retinol and the like.
- The topically active pharmaceutical or cosmetic composition should be applied in an amount effective to affect changes in the pigmentation of mammalian skin. As used herein “amount effective” shall mean an amount sufficient to cover the region of skin surface where a change in pigmentation is desired. Preferably, the composition is liberally applied to the skin surface such that, based upon a square cm of skin surface, from about 2 μl/cm2 to about 200 μl/cm2 of topically active agent is present when a change in pigmentation is desired. When using a thrombin and trypsin inhibitor such as compound I or its analogs, whether synthetically- or naturally-derived in a formulation, such an active compound should be present in the amount of from about 0.0001% to about 15% by weight/volume of the composition. More preferably, it should be present in an amount from about 0.0005% to about 5% of the composition; most preferably, it should be present in an amount of from about 0.001 to about 1% of the composition. Of course, these ranges are suggested for the foregoing components. The lower set of ranges is intended to be efficacious for PAR-2 pathway agonists/antagonists and/or inhibitors having high therapeutic indices and which do not require significantly larger concentrations or doses to be effective in the methods of this invention. Such compounds may be synthetically- or naturally-derived.
- Liquid derivatives and natural extracts made directly from plants or botanical sources may be employed in the compositions of this invention in a concentration (w/v) from about 1 to about 99%. Fractions of natural extracts and naturally-derived protease inhibitors such as STI may have a different preferred range, from about 0.01% to about 20% and, more preferably, from about 1% to about 10% of the composition. Of course, mixtures of the active agents of this invention may be combined and used together in the same formulation, or in serial applications of different formulations.
- We have unexpectedly found that when topically active agents, such as PAR-2 agonists and/or inhibitors and tryosin and/or thrombin and/or tryptase and/or their inhibitors, are topically applied to an animal's skin, a significant change in pigmentation was achieved. Preferably, depigmenting agents (as well as other pigmentation-affecting agents of this invention) are applied to the skin of a mammal at a relatively high concentration and dose (from about 0.005% to about 1% for compounds having high therapeutic indices such as Compound I and related compounds; from about 20% to about 99% for liquid derivatives and extracts of botanical materials; and from about 1% to about 20% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof) between one and two times daily for a period of time until the skin evidences a change in pigmentation. This may be for from about four to about ten weeks or more. Thereafter, once the change in pigmentation has been achieved, a lower concentration and dose (from about 0.00001% to about 0.005% for compounds having high therapeutic indices such as Compound I and related compounds; from about 10% to about 90% for liquid derivatives and extracts of botanical materials; and from about 0.01% to about 5% for fractions of natural extracts and naturally-derived protease inhibitors such as STI or mixtures thereof), of active ingredient may be applied on a less frequent time schedule, e.g., about once per day to about twice per week. The effects of the active agents of this invention are reversible, therefore, in order to maintain these effects, continuous application or administration should be performed. The invention illustratively disclosed herein suitably may be practiced in the absence of any component, ingredient, or step which is not specifically disclosed herein.
- Several examples are set forth below to further illustrate the nature of the invention and the manner of carrying it out, but do not serve to limit the scope of the methods and compositions of this invention.
- In order to study the possible roles of the PAR-2 pathway in pigmentation, an in vitro epidermal equivalent system was used. The epidermal equivalent system used contained melanocytes. One epidermal equivalent system which is useful in performing this study is the MelanoDerm system, available commercially from MatTek Co. This system contains human normal melanocytes, together with normal, human-derived epidermal keratinocytes, which have been cultured to form a multi layered, highly differentiated model of the human epidermis. In the following examples, equivalents were treated with test compounds for three days and samples were harvested on the fourth day after beginning of treatment. The harvested equivalents were stained with DOPA (a substrate for tyrosinase) and H&E (a standard histological stain) or with Fontana-Mason (F&M) staining, another stain known to those of skill in the art. F&M staining is a silver staining technique that clearly and cleanly marks melanins which have high silver nitrate reducing activity.
- Multilayered human epidermal equivalents containing melanocytes were used as an in vitro model system to study the effect of protease inhibitors on melanogenesis. Epidermal equivalents used were commercially available as MelanoDerm from MatTek of Ashland, Mass. These equivalents are known to respond to ultraviolet B (“UVB”) irradiation and known whitening agents such as benzaldehyde and hydroquinone by increasing and reducing pigmentation, respectively. The MelanoDerm epidermal equivalents were exposed to benzaldehyde (available from Sigma of St. Louis, Mo.), hydroquinone (available from Sigma) and UVB irradiation. UV irradiation was performed with a UVB FS light source in an exposure chamber, with plate covers removed and Phosphate-buffered saline (PBS, from Gibco-BRL, Gaithersburg, Md.) present in the lower chamber. UVB intensity was measured with a UVX radiometer (UVP Inc., San Gabriel, Calif.). Equivalents were treated with 0.1-0.12 J/cm2 No loss of viability was observed in equivalents treated with up to 0.3 J/cm2.
- On the fourth day of exposure to the test compounds/ultraviolet irradiation, the equivalents were fixed, sectioned and stained, or stained as whole without sectioning. MelanoDerm equivalents were formalin fixed and put in paraffin blocks, and sections from the MelanoDerm equivalents were stained in accordance with the following standard procedures: (1) H&E, (2) DOPA+H&E and (3) Fontana-Mason (“F&M”) using standard techniques known to those of skill in the art. Alternatively, whole MelanoDerm equivalents were stained and their images were captured for image analysis. At least three sections per equivalent, three equivalents per experiment were processed. Each experiment was repeated three time. DOPA is a substrate for tyrosinase.
- F&M identifies silver nitrate reducing molecules, which identifies primarily melanins. F&M stained sections were used for image analysis using Optomax Image Analysis Systems, from Optomax Inc., Hollis, N.H. Alternatively, Empire Images database 1.1 was used on a Gateway 2000 PS-100 computer (Media Cybernetics, Silver Springs, Md.) for capturing images. Image Pro Plus version 4.0 was used for image analysis. Parameters measured were as follows: (1) level of pigmentation within individual melanocytes and (2) number of pigmented melanocytes per field, for the Optomax system, or (1) the surface area of silver deposits within melanocytes and (2) the number of pigmented melanocytes for the Image Pro system. Using the Optomax system, surface area of silver deposits within individual melanocytes was measured in 60 melanocytes, using multiple sections from triplicate equivalents per treatment. The number of melanocytes per field was calculated in these sections. A “pigmentation factor” was defined as the average surface area of silver deposits within an individual melanocyte, multiplied by the number of pigmented melanocytes per field. A value of one was assigned to untreated controls, and values of treatment groups were normalized to their relevant controls. Using the Image Pro system, surface area of silver nitrate deposits and number of melanocytes were measured for whole equivalents. A value of one was assigned to untreated controls and values of treatment groups were normalized to their relevant controls.
-
FIG. 1A is a graph depicting the increase or decrease in relative pigmentation, as measured and calculated by the whole equivalent/Image Pro system, as set forth above, when exposed to benzaldehyde (500M), hydroquinone (50 M) and UVB irradiation (0.12 J/cm2). - The human epidermal equivalents were also exposed to mixtures of protease inhibitors, said protease inhibitors are set forth in Table A below. The protease inhibitors were available from Boehringer Mansheim of Indianapolis, Ind. Complete® Protease Inhibitor Cocktail tablets available from Boehringer Mannheim were used, containing inhibitors of chymotrypsin, thermolysin, papain, pronase, pancreatic extract and trypsin. Soybean trypsin inhibitor (“STI”) was available from Sigma and was dissolved in a 50 mg/ml liposome vehicle or in 1×PBS. All other protease inhibitors used in this in vitro example were dissolved in 1×PBS. GDL liposomes were prepared as set forth in Niemic, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van Dyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. These mixtures of protease inhibitors and different combinations of serine protease inhibitors were tested for their ability to affect melanogenesis. As set forth in
FIG. 1B , some of the serine protease inhibitors, particularly STI (soybean trypsin inhibitor), were very effective in inhibiting melanogenesis. -
TABLE A Test Formulation Ingredients Complete ® Total protease inhibitor mixture - x Mix-1 Serine Protease inhibitors - 90 μg/m Phenylmethyl-sulfonyl fluoride (“PMS and 50 μg/mL L-1-Chloro-3-[4-tosylamido] phenyl-2-butanone (“TPCK”) Mix-2 Serine protease inhibitors - 0.1 μg/ aprotinin, 50 μg/mL Soybean trypsin inhibitor (“STI”), 0.5 μg/mL leupeptin and 0.2 μg/mL (L-1-Chloro-3-[4-tosylamido]-7-amino heptanone-HCl) (“TLCK“) STI Soybean trypsin inhibitor - 1 mg/ml - Example 1 demonstrates that STI reduces pigmentation. STI inhibits trypsin. Because trypsin is known to activate TR and PAR-2, we tested the possible involvement of TR and PAR-2 in pigmentation. MelanoDerm human epidermal equivalents were treated with the TR and PAR-2 agonists and antagonists set forth in Table B below daily for three days. On the fourth day, the samples were harvested, fixed, and DOPA, H&E or F&M staining was performed. Histological and whole-equivalent examination revealed changes in pigmentation following the treatments.
FIG. 2 depicts the results of this example. As shown therein, the PAR-2 peptide agonist SLIGRL induced pigmentation in individual melanocytes. Treatment with Compound I, an inhibitor of thrombin and trypsin, resulted in decreased pigmentation. -
FIG. 3 shows the results of the studies set forth in this example, representing the level of pigmentation in MelanoDerm equivalents treated with TR and PAR-2 reagents. SLIGRL, a PAR-2 agonist, dramatically increased pigmentation, indicating that PAR-2 might be involved in pigmentation. Hirudin, a thrombin-specific inhibitor, and TFLLRNPNDK, a TR selective agonist had no effect on pigmentation. However, SFLLRN, a less specific TR agonists, showed a trend of lightening or reducing pigmentation. This indicates that TR is less likely to be involved in pigmentation. -
TABLE B TR and PAR-2 Reagents Description Thrombin Activates TR Trypsin Activates TR and PAR-2 TFLLRNPHDK TR peptide agonist - activates TR only SLIGRL PAR-2 peptide agonist - activates PAR-2 o SFLLRN TR peptide agonist - activates TR, cross-reacts with PAR-2 FSLLRN Scrambled peptide - inactive Hirudin Specific inhibitor of thrombin Compound I Thrombin and trypsin inhibitor - MelanoDerm equivalents were treated with increasing concentrations of SLIGRL, the PAR-2 peptide agonist, at 0, 10 and 50 μM in the same manner as set forth in Example 2. F&M staining was performed in the fourth day. As shown in
FIG. 4A , increasing concentrations of SLIGRL, the PAR-2 activator, result in increased pigmentation. Trypsin, a PAR-2 activator, has the same effect. Treatment with increasing concentrations of Compound I, the thrombin and trypsin inhibitor, from 0.1 pM to 1 μM resulted in decreasing pigmentation (seeFIG. 4A ). Pretreatment of the equivalents with UVB irradiation increased melanogenesis, relative to untreated controls. Compound I was able to reduce this UVE-induced pigmentation as well (FIG. 4B ). This example demonstrates a dose-response relation for increasing and decreasing pigmentation with the modulation of PAR-2 signaling. This example also demonstrates that Compound I can inhibit pigmentation and prevent UV-induced pigmentation. - PAR-2 and TR expression have been demonstrated previously in keratinocytes and fibroblasts. This example demonstrates that PAR-2 is expressed in keratinocytes, but not in melanocytes. Furthermore, it demonstrates that TR is expressed in both keratinocytes and melanocytes.
- In order to demonstrate this, MelanoDerm human epidermal equivalents, human primary melanocyte cultures (neonatal and adult, from Clonetics of San Diego, Calif.) and Cloudman S91 mouse melanoma cells from ATCC of Rockville, Md. were grown in culture and total RNAS were extracted using “RNA Stat-60” reagent available from “Tel-Test B”, Incorporated as described in Chomczymski, “Single Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-phenol-chloroform extraction,” 162 Anal. Biochem. 156-69 (1987). A sufficient amount of RNase-free DNase available from Promega Corporation under the tradename “RQ1 RNase-free DNase” was then added to the extracted RNA from each sample such that each respective product will yield 200 ng of DNased-RNA using the procedure set forth in “RNase-free DNase”, protocol published by Promega Corporation (May, 1995). The resulting 200 ng of DNased-RNA was reverse transcribed (“RT”) via the procedure set forth in “Superscript II Reverse Transcriptase” a protocol published by Gibco-BRL (now Life Technologies, Incorporated) (April 1992), using random hexamers such as the random primers which are commercially available from Life Technologies, Incorporated.
- The resulting RT products were then amplified via polymerase chain reaction (“PCR”) using about a 0.5 unit (per 100 μl reaction) of a thermostable DNA polymerase which is commercially available from Perkin-Elmer-Cetus Corporation under the tradename “Taq polymerase” and about 0.1 μmol/reaction of TR and PAR-2 specific primers as described in Table C and in Marthinuss et al., 1995 which is hereby incorporated herein by reference or of glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) primers, available from Clontech Laboratories, Inc. of Palo Alto, Calif. in accordance with the procedures set forth in Marthinuss et al., 1995 or in the protocol accompanying the primers from Clontech Laboratories.
- The PCR products were then analyzed using 2% agarose/ethidium bromide gels according to methods well-known in the art in order to compare the level of expression of certain genes in keratinocytes and melanocytes. When necessary for better visualization, the resulting PCR products were precipitated with ethanol according to well-known procedures. When primers for G3PDH were used, only 10% of the PCR reaction products were used. An RNA sample from epidermal equivalents that was not reverse-transcribed was used as a negative control for each PCR amplification. The lack of genomic DNA contaminants was indicated by the lack of a band on the relevant lanes in the gels. A human skin RNA sample which was reverse-transcribed was used as a positive control when commercial positive controls were not available. The migration of the RT-PCR products on the gels was always identical to that of the positive controls, and to that of the reported amplimer sizes.
- The relative quality of each respective RT-PCR reaction product was then compared by analyzing the mRNA level of G3PDH, a “housekeeping” gene, in each respective product. As illustrated in
FIGS. 5 and 6 , G3PDH gene expression was found to be similar at all the time points examined, which thereby enabled the comparison of the relative levels of gene expression for the desired genes. -
FIG. 5A shows that, as expected, TR and PAR-2 are expressed in total skin and in the MelanoDerm equivalents (“MD”). However, S91 melanoma cells (“S91”) did not express PAR-2 or TR. To investigate this further, we tested primary newborn (“mel-NB”) and adult (“mel-A”) melanocytes for TR and PAR-2 expression. As shown inFIG. 5B , primary human melanocytes express TR but not PAR-2. Therefore, we suggest that PAR-2 agonists and antagonists can interact with keratinocytes, but not with melanocytes, in the MelanoDerm equivalents, and that TR agonists and antagonists could interact with both keratinocytes and melanocytes. A keratinocyte-melanocyte interaction is, therefore, suggested, during which the keratinocyte-PAR-2 signal is converted into a pigmentation end point. - Table C illustrates some of the DNA primers used, the amount of MgCl2 required for the PCR reaction, and the length of the PCR cycle.
-
TABLE C DNA Primers Utilized in RT-PCR Assay Amt. DNA Primer of Cycle No. Seq. (See attached MgCl2 (min) @ of ID Sequence Listing) (mM) ° C. cycles No. Tyrosinase sense 1.25 1 @ 94 35 1 TCAGCCCAGC ATCCTTCTTC 2 @ 55 3 @ 72 Tyrosinase antisense 1.25 1 @ 94 35 2 CAGCCATTGT TCAAAAATAC 2 @ 55 TGTCC 3 @ 72 TRP-1 sense 2.5 1 @ 94 35 3 5′CCACTCTAATAAGCCCAAAC 2 @ 55 3 @ 72 TRP-1 antisense 2.5 1 @ 94 35 4 5′CTCAGCCATTCATCAAAGAC 2 @ 55 3 @ 72 TRP-2 sense 2.5 1 @ 94 35 5 5′AAAAGACATACGAGATTGCC 2 @ 55 3 @ 72 TRP-2 antisense 2.5 1 @ 94 35 6 5′CACAAAAAGACCAACCAAAG 2 @ 55 3 @ 72 Trypsin sense 2.5 1 @ 94 35 7 5′ATCC/TACTCCTGATCCTTACC 2 @ 45 3 @ 72 Trypsin antisense 2.5 1 @ 94 35 8 5′TGTCATTGTT/CCAGAGTCT/ 2 @ 45 CT/GC/GC 3 @ 72 PAR-2 sense - 2.5 .5 @ 94 30 9 GGGAAAGGGGTTGGGGTAGA 1 @ 55 CCAGGCTTTTCC (5′) 3 @ 72 PAR-2 antisense - 2.5 .5 @ 94 30 10 GGCCAACGGCGATGTTTGCCTT 1 @ 55 CTTCCTGGGG (3′) 3 @ 72 TR-sense - 2.5 .5 @ 94 30 11 CCTCTGAGTGCCAGAGGTACG 1 @ 55 TCTACAG (5′) 3 @ 72 TR-antiseense - 2.5 .5 @ 94 30 12 CCTAAGTTAACAGCTTTTTGTAT 1 @ 55 ATGCTGTTATTCAGG (3′) 3 @ 72 Thrombin-sense - 2.5 .5 @ 94 35 13 AACCTGAAGGAGACGTGGAC 1 @ 55 (3′) 3 @ 72 Thrombin-antisense - 2.5 .5 @ 94 35 14 CAGGAGCCCAGAATATGAGTG 1 @ 55 (5′) 3 @ 72 - The results of Example 4 suggest that melanocytes alone might not respond to the depigmenting effect of PAP-2 antagonists. Indeed, the level of pigmentation of human primary melanocytes or choleratoxin-induced S91 cells, which is reduced by hydroquinone and benzaldehyde, was not affected by Compound I.
- Since PAR-2 is not expressed in melanocytes, we tested the possible requirement of keratinocyte-melanocyte interactions for the depigmenting effect of Compound I. Primary melanocyte cultures were compared to identical cultures plated under epidermal equivalents (EpiDerm, lacking melanocytes) to create a co-culture with no contact between keratinocytes and melanocytes. These were also compared to MelanoDerm equivalents, where melanocytes are present in the basal layer of the equivalent. Cultures were treated for three days with Compound I, with the PAR-2 agonist SLIGRL, and with the TR agonist TFLLRNPNDK, as set forth in Table D, and DOPA stained on the fourth day. In Table D, keratinocytes are indicated by “K”, melanocytes are indicated by “M” and lack of keratinocyte-melanocyte contact is indicated as “no K-M contact”. As shown in Table D, no effect on pigmentation was observed in primary melanocytes and in co-cultures treated with these agents. In MelanbDerm equivalents, compound I reduced and SLIGRL induced pigmentation, while TFLLRNPNDK had no effect. These results demonstrate that keratinocyte melanocyte contact is required for the PAR-2 effect on pigmentation.
-
TABLE D Melanocytes Co-cultures MelanoDerm Treatment (no K) (no K-M contact) (K-M contact) Compound I no effect no effect lightening SLIGRL no effect no effect darkening TFLLRNPNDK no effect no effect no effect - MelanoDerm equivalents were treated with increasing concentrations of the thrombin and trypsin inhibitor, Compound I, or with increasing concentrations of the PAR-2 agonist SLIGRL. RNAs extracted from untreated and Compound I-treated equivalents were analyzed for gene expression by RT-PCR in the manner set forth above in Example 4. Gene-specific primers were designed as set forth in Table C above, and Clontech primers for human G3PDH were used as in Example 4. Melanogenic genes tested for expression level were tyrosinase, TRP-1, and TRP-2.
- A dose-dependent decrease in TRP-1 and a dose-dependent increase in TRP-2 mENA levels were observed in Compound I-treated samples, as shown in
FIG. 6A . Tyrosinase expression, however, was not affected. These changes correlated with the dose-dependent whitening effect of this inhibitor. Both patterns of gene expression result in a lightening effect. TRP-2 enzyme processes dopaquinone to 5,6-dihydroxyindole carboxylic acid (DHICA), rather than to 5,6-dihydroxyindole (DHI). This process results in brown, finely dispersed eumelanin, as opposed to insoluble black eumelanin, and results in a lighter skin tone. TRP-1 stabilizes the melanogenic complex, enabling pigment production. Reduced levels of TRP-1 result in reduced tyrosinase activity and reduced pigmentation. Lack of this protein results in albinism. Increasing concentrations of SLIGRL, however, did not affect melanogenic gene expression (FIG. 6B ). - TRP-1 and TRP-2 are melanocyte-specific. Compound I inhibits trypsin and thrombin. Hirudin, a specific thrombin inhibitor, had no effect on pigmentation, as seen above in Example 2. Thus, we decided to test whether trypsin and thrombin are expressed in skin. A probe designed to detect both brain and gastric trypsins, as described in Table C, detected the expression of both mRNAs in a total skin mRNA sample available from Invitrogen of Carlsbad, Calif., as well as in MelanoDerm equivalents. The same expression pattern was detected for thrombin. Both trypsin and thrombin were not expressed in normal melanocytes (
FIGS. 5A , B). These data suggest that if trypsin activates PAR-2, it could be produced by the keratinocytes only. As shown inFIG. 6A , treatment with Compound I resulted in increased expression of trypsin. SLIGRL, which did not affect melanogenesis gene expression (FIG. 6B ) also increased trypsin expression in the equivalents. We conclude that while trypsin is a possible natural activator of PAR-2 in skin and possibly affects pigmentation, its mRNA levels do not correlate with pigmentation. This suggests that another, yet unidentified serine protease, which is inhibited by compound I, STI and the like, is the natural activator of PAR-2 in the epidermis. Compounds that induce or inhibit this protease would serve as darkening and lightening agents, respectively. - Two guinea pigs were treated twice daily, five days/week for seven weeks with Compound I at 1 and 10 μM in 70:30 ethanol:propylene glycol vehicle on one pigmented nipple. The other nipple of each animal was treated with vehicle only and served as a control. Chromameter measurement after seven weeks of treatment revealed a dose-dependent lightening effect of +9.6 L* and nearly 18 L* units respectively. No visible signs of irritation were observed at that time.
- Four groups of three guinea pigs each were treated respectively with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 μM, twice daily five days per week for eight weeks. Chromameter measurement after six weeks demonstrates a lightening effect by Compound I and a darkening effect by SLIGRL, the PAR-2 agonist. The results of this example are set forth in
FIG. 7 . - A Yucatan mitroswine was treated with Compound I, SFLLRN, FSLLRN and SLIGRL at 10 μM. Each compound was applied to two sites on the pig twice daily, five days per week for eight weeks. After eight weeks of treatment, chromameter measurements were taken. The application of Compound T resulted in a visible lightening effect. The PAR-2 agonist SLIGRL resulted in a darkening effect as measured by chromameter. SFLLRN and FSLLRN had no significant effects.
- Two Yucatan swine were treated for seven and a half weeks, or for ten weeks, twice daily, five days per week, with increasing concentrations of Compound I. Four concentrations of active compound were used, as follows: 0, 10, 50 and 250 μM. Two sites per concentration were placed on opposite sides of the swine dorsum. Chromameter measurements were taken before treatment started and every two weeks thereafter. Pictures were taken periodically and at the end of the experiment. A visible lightening effect was observed during the 4th, 5th and 6th weeks of treatment, for the 250, 50 and 10 μM treatments, respectively. By the eighth week, the whitening effect of the two highest doses was similar. These results are illustrated in
FIG. 8 . The chromameter readings (L*, measuring brightness) during the treatment course of one swine are shown inFIG. 9 . A saturation effect is observed, which is a time and concentration dependent. This example demonstrates a visual depigmenting effect by Compound I, in the animal model system most resemble pigmented human skin. - At the end of these experiments, biopsies were taken for histological and electron microscopy (EM) analyses. Histological samples were stained with HEE and F&M. H&E staining showed that there was no irritation, inflammatory response or changes in skin architecture, demonstrating the safety of using Compound I over long periods of time. F&M staining demonstrated that there was reduced pigmentation in the treated samples, both in the basal layer and throughout the epidermis. These results are illustrated in
FIG. 10 . Untreated and vehicle-treated samples (FIG. 10A ) were identical and darkest. The 10 μM treatment (FIG. 10B ) showed reduced pigmentation and the 50 and 250 μM treatments (FIGS. 10C , 10D, respectively) were the lightest. - The results of this example suggest that the maximal whitening effect of Compound I could be achieved with higher concentration over a shorter period of time or with lower concentration over a longer period of time. Thus, at least two difference regimens may be used to achieve the desired skin whitening results.
- Ultrastructural analysis was performed on MelanoDerm equivalents and swine skin sites treated with Compound I. MelanoDerm equivalents treated with Compound I were analyzed for melanosome formation and distribution using electron microscopy. Treated samples contained more melanosomes, but less mature melanosomes, i.e., melanosomes which evidence reduced melanin production, within the melanocytes, relative to untreated controls (
FIGS. 11A , 11B). Dendrites containing melanosomes were easily identified within treated keratinocytes (FIG. 11C ), but were difficult to find within control keratinocytes. This suggests abnormal melanosome formation and slow or impaired melanosome transfer into keratinocytes in the treated samples. - Skin samples from Yucatan swine treated with compound I for eight weeks, as described in example 8, were also analyzed by electron microscopy. Melanosomes within keratinocytes of treated sites were smaller and less pigmented, compared to controls (
FIGS. 11D , 11E and 11F). Moreover, the distribution of melanosomes within the treated skins was abnormal. Melanosomes were detected mainly at the epidermal-dermal border, compared to a random distribution in untreated controls (FIGS. 11G , 11H). While we cannot rule out other mechanisms, we suggest that Compound I treated keratinocytes were unable to actively take or receive melanosomes from the presenting dendrites. - A Yucatan swine was treated with Compound 1,250-M, for eight weeks, twice daily, five days a week, on eight sites. All sites showed visible depigmentation by the end of the treatment period, as set forth in
FIG. 12B . For the following four weeks (starting at week nine of the experiment), the color of the treated sites was monitored, and two biopsies were taken each week from two treated sites. Untreated sites were biopsied as well. The depigmenting effect could be visualized at one and two weeks post treatment, and a complete reversal was observed by the forth week. Histological examination of F&M stained skin sections confirmed the repigmentation observed visually (as indicated inFIG. 12 ). As early as one week post treatment, repigmentation was demonstrated histologically. The visual observations correlate with the histological demonstration of stratum corneum pigmentation. This example demonstrates that Compound I does not induce a permanent damage to the pigmentation machinery, and its effect is reversible in vivao.FIG. 12A shows two histological F&M stained sections of sites which were not treated with Compound I.FIG. 12B shows two histological F&M stained sections of sites which were treated with Compound I for eight weeks.FIG. 12C shows sections of sites which were treated for eight weeks with Compound I, one week after treatment was stopped.FIG. 12D shows sections of sites which were treated for eight weeks with Compound I, two weeks after treatment was stopped.FIG. 123 shows sections of sites which were treated for eight weeks with Compound I, four weeks after treatment was stopped. As indicated inFIG. 12E , the sections were fully repigmented four weeks after the end of treatment. - Example 1 demonstrates that the presence of soybean trypsin inhibitor in any lightening formulation is desirable for its depigmenting activity. Based on analytical testing, it has been determined that soybean milk and soybean paste are rich sources of soybean trypsin inhibitor.
- To make soybean paste, soybeans were first soaked in deionized or purified water for several hours. The soybeans were ground after they were fully hydrated, with the addition of small quantities of water, if needed, to smoothen the paste. To make soybean milk, the same procedure was performed with the addition of more water. (The grinding process allows the soybean milk to be extracted). After collection, the soybean milk was filtered to remove any residual parts of the bean husk.
- Soybean milk, soybean paste and miso were prepared to be used as naturally-derived materials that contain STI and are able to lighten skin color.
- Two Yucatan swine were treated for eight and ten weeks, twice a day, five days a week, with different soybean- and lima-bean-derived products. These natural products include soybean paste, soybean protein acid hydrolysate, misc, native and boiled soybean milk, and a commercially available extract of soybean (Actiphyte® of Active Organics, Dallas Tex.), as well as purified STI, and different preparations of trypsin inhibitors from soybeans and limabeans. At seven weeks of treatment, all sites were visually lighter than the surrounding skin, except for the boiled soybean milk and the soybean protein acid hydrolysate treated sites. Histological analysis of biopsies from the treated sites following F&M staining confirmed the depigmenting effect of the soybean and limabean products. An example of such histological data is given in
FIG. 13 . The lack of depigmenting activity in the boiled soybean milk and in the soy protein acid hydrolysate is explained by the denaturation or the degradation of the soy proteins in these preparations, respectively. We theorize that the active depigmenting agents in the soybean and limabean products are soybean trypsin inhibitor (STI) and limabean trypsin inhibitor, respectively. (Example 1 shows the depigmenting effect of STI in vitro). This example demonstrate that natural extracts containing trypsin inhibitory activity could be used as whitening agents which affect the PAR-2 pathway. - An individual with three age spots on the dorsum of their hand was treated for eight weeks, twice a day, with the following: The age spot located closest to the arm was treated with placebo, containing 20 mg/ml of liposomes. The middle age spot was not treated. The third age spot was treated with STI, 1%, in liposomes (20 mg/ml). GDL liposomes were prepared as set forth in Niemiec, et al., above, with the exception of the following changes: the non-ionic liposomal formulation contained glycerol dilaurate (Emulsynt GDL, ISP Van tyk)/cholesterol (Croda)/polyoxyethylene-10-stearyl ether (Brij76, ICI)/polyoxyethylene-9-lauryl ether, as at ratio of 37.5:12.5:33.3:16.7. Hepes buffer, 0.05M, pH 7.4 (Gibco-BRL of Gaithersburg, Md.) was used as the aqueous phase in the preparation of the liposomes. UV and visible light digital pictures were taken at
time - As shown in
FIG. 14 , the age spot treated with STI became lighter following 8 weeks of treatment.FIG. 14 is a composite of four pictures. The left panel is the visible light pictures of the hand, before (upper) and after (lower) 8 weeks of treatment. At this orientation the top age spot is the placebo-treated, the middle age spot is untreated, and the lower age spot is the STI-treated. The right panel shows the same hand at the same time points, using UV-photography. UV light enables the visualization of pigment deeper in the skin, demonstrating that the STI whitening effect was not superficial.FIG. 14 clearly demonstrates that the STI formulation was able to lighten the lower age-spot. An increase of 15 L* units was calculated for this STI-treated site, further demonstrating the ability of this treatment to lighten age spots. - In making the soybean milk, it was discovered that the rich emolliency of the milk would be desirable in a skin care formulation. Because water is used as the predominant ingredient of any oil-in-water emulsion, and in many other skin-care formulations we hypothesized that the soymilk could be used to substitute for the deionized water in such formulations. However, we expected that this type of formulation would not be physically stable due to the immiscibility of the oil and water components of the soybean milk. Surprisingly, we found that this substitution of soybean milk for water was physically stable. Formulations utilizing soybean milk should contain between about 1% and about 99% of soybean milk, more preferably from about 80% to about 95% soybean milk. Preferably, this and similar formulations should include a viscosity builder in an amount from about 0% to about 5% (more preferably, from about 0.1 to about 2%), one or more emollients in an amount up to about 20% and/or emulsifiers in an amount from about 0.1% to about 10% (more preferably from about 3 to about 5%), and, optionally, a spreading agent in an amount from about 0 to about 5% (more preferably from about 1 to about 2%), a preservative, a chelating agent or a humectant. The preservative should be present in an effective amount in order to preserve integrity of the milk and maintain the composition's activity. Sufficient thickener should be present to impart body to the formulation without causing it to become so viscous that it would hinder spreadability, e.g., from about 0 to about 10%, more preferably from about 3 to about 5%. Sunscreen, antioxidants, vitamins other depigmenting agents and other skin care topical ingredients may also be incorporated into the compositions of this invention.
- A particularly preferred example of a depigmenting formulation substituting soymilk for water is shown in table E below.
-
TABLE E Ingredient Function % Wgt/Wgt soybean milk Vehicle, depigmenting 84.9% aluminum starch viscosity builder 0.75% octenyl succinate cyclomethicone spreading agent 2% PEG 6-capric/caprylic emollient/ emulsifier 3% triglycerides phenoxyethanol preservative 0.75% sucrose cocoate emollient/ emulsifier 1% Na2EDTA chelating agent 0.1% glycerin humectant 2.5% polyacrylamide; thickener 5% isoparaffin; laureth-7 - STI, soybean paste and other trypsin inhibitor-containing natural extracts can be incorporated into such formulations to provide increasing concentrations of the serine protease inhibitor. Use levels of the added active ingredient can range between 0.01% to 15% in a formulation. Other depigmenting agents, including PAR-2 inhibitors, tyrosinase inhibitors, hydroquinones, soy products, ascorbic acid and its derivatives, as well as other ingredients with skin care benefits could also be incorporated into this formulation.
- Two examples of a depigmenting formulation with oil-in-water emulsion are presented in Table F. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in
column 4 of Table F. A similar formulation with Compound I is presented incolumn 5 of Table F. Compound I in this composition could be replaced with similar compounds, or with serine protease inhibitors or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table F. The deionized water content of these formulations could be replaced with soybean milk. -
TABLE F Phase CTFA Name Function % W/W % W/W Ranges OIL Cetearyl Glucoside Surfactant 1.4 1.4 0.1-2.8 C12-15 Alkyl Surfactant 4.0 4.0 1-6 Benzoate Octyl Emollient 1.0 1.0 0-5 Hydroxystearate Dimethicone Spreading 1.0 1.0 0-5 Agent Cyclomethicone Spreading 1.0 1.0 0-5 Agent Cetyl Alcohol Emollient 2.5 2.5 0-4 Butylated Anti- 0.1 0.1 0-0.5 Hydroxytoluene oxidant Octyl Sunscreen 6.0 6.0 0-10 Methoxycinnamate Propylparaben Preservative 0.5 0.1 0-0.5 Vitamin E acetate Anti- 0.5 0.5 0-0.5 oxidant Tocopherol Acetate Anti- 0.5 0.5 0-0.5 oxidant AQUEOUS Glycerine Humectant 3.0 3.0 0-20 D-Pathenol Pro-Vitamin 0.5 0.5 0-5 Disodium EDTA Chelator, 0.1 0.1 0.01-1 whitening agent Methyl Paraben Preservative 0.2 0.2 0-0.3 Carbomer Thickener 0.35 0.35 0-3 Deionized Water or Carrier/ 76.35 77.5 50-80 Soybean Milk Whitening Agent STI or natural Whitening 1.0 0 0-15 extract Agent Compound I Whitening 0 0.25 0-1 Agent - To prepare this formulation, the ingredients of the lipid phase were combined and mixed at 85° C., and then cooled to 60° C. In a separate vessel, the carbopol was slowly added to the water or to the soybean milk. After mixing for ten minutes the rest of the aqueous phase ingredients were added and the mix was heated to 60° C. The two phases were then combined, mixed for ten minutes, and cooled to room temperature. Of course, one or more depigmentation agents may be combined within the same formulation, in this Example and in the following examples and other embodiments of the methods and compositions of this invention.
- Two additional examples of an oil-in-water emulsion depigmenting formulation are presented in Table G. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in
column 3 of Table G. A similar formulation with Compound I is presented incolumn 4 of Table G. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table G. The deionized water content of these formulations could be replaced with soybean milk. -
TABLE G Pref'd. CTFA Name Function % W/W % W/W Ranges Ethanol Solvent 12.0 12.0 5-20 Propylene Glycol Solvent 3.0 3.0 1-10 Hydroxyethylcellulose Thickener/ 0.2 0.2 0-3 Polymer Acrylates/C10-30 Thickener/ 1.0 1.0 0-3 Alkyl Acrylate Polymer Crosspolymer Panthenol (98%) Pro-Vitamin/ 1.5 1.5 0.1-3 Humectant Fragrance Fragrance 0.5 0.5 0-0.5 Isohexadecane Spreading 4.0 4.0 0-5 Agent Vitamin E acetate Anti-oxidant 1.0 1.0 0-2 Sodium Hydroxide Neutralizer 0.35 0.35 0.1-0.5 Glycerine Humectant 3.0 3.0 0-20 Deionized Water or Carrier/ 72.2 71.95 60-80 Soybean Milk Whitening Agent Compound I Whitening 0 0.25 0-1 Agent STI or natural extract Whitening/ 1.0 0 0-15 Agent - To prepare this formulation, the hydroxyethylcellulose was slowly added to the water or to the soybean milk and stir until completely dissolved. In a separate container the Acrylates/C10-30 Alkyl Acrylate Crosspolymer was added and stir until completely dissolved. The content of the two containers was combined and mixed for 20 minutes Vitamin E acetate was then added and mixed, following by the addition of Isohexadecane and Panthenol (98%). After mixing for five minutes the STI, or the natural extract, or Compound I were added together with Propylene Glycol, and stirred for 5 minutes. Next, glycerine was added and the formulation was stirred for 20 minutes. Finally, the pH was adjusted with sodium hydroxide to 8 for STI (range is 6-8.5) or to 7 for Compound I (range is 5.5-8.5).
- An example of a depigmenting formulation with water-in-oil emulsion is presented in Table H. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in
column 4 of Table H. A similar formulation with Compound I is presented incolumn 5 of Table H. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table H. The deionized water content of these formulations could be replaced with soybean milk. -
TABLE H Pref'd Phase CTFA Name Function % W/W % W/W Ranges OIL Mineral Oil Emollient 25.0 25.0 40-80 Sorbitan Surfactant 5.0 5.0 1-6 Monooleate Stearyl Alcohol Emollient 25.0 25.0 20-60 Dimethicone Spreading Agent 1.0 1.0 1-5 Cetyl Alcohol Emollient 2.0 2.0 0.1-10 Hydrogenated Anti-oxidant 3.0 3.0 0-10 Lecithin Parsol MCX Sunscreen 3.0 3.0 0-10 Propylparaben Preservative 0.5 0.5 0.01-0.5 Vitamin E Anti-oxidant 0.5 0.5 0.01-0.5 acetate AQUEOUS Glycerine Humectant 3.0 3.0 0-20 Methyl Paraben Preservative 0.2 0.2 0.01-0.3 Water or Soy Carrier/ 30.8 31.55 20-45 Milk Whitening Agent STI Whitening Agent 1.0 0 0-10 Cpd I Whitening Agent 0 0.25 0-1 - To prepare this formulation the stearyl alcohol and mineral oil were melted at 70° C. The other oil phase ingredients were added and the mixture heated to 75° C. The aqueous phase ingredients, which have been previously dissolved in the bulk phase water or Soy Milk and warmed to 70° C., were then added and the mixture was stirred until it congealed.
- Two examples of a depigmenting formulation with aqueous gel are presented in Table J. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in
column 3 of Table J. A similar formulation with Compound I is presented incolumn 4 of Table J. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table J. The deionized water content of these formulations could be replaced with soybean milk. -
TABLE J CTFA Name Function % W/W % W/W Octoxynol-13 Surfactant 0.2 0.2 0.05-0.5 2,4- Preservative 0.1 0.1 0-0.3 Hexadienoic Acid Benzenemethanol Preservative 1.0 1.0 0-2 Disodium EDTA Chelator/ 0.05 0.05 0.01-0.2 Preservative Ascorbic Acid Anti-oxidant 0.1 0.1 0-0.2 Sodium Anti-oxidant 0.2 0.2 0-0.3 Metabisulfite Carbomer Thickener 1.5 1.5 0-3.0 NaOH %20 Soln. Neutralizer 2.45 2.45 0.1-5 DEIONIZED Carrier/ 93.4 94.15 85-98 Water or Whitening Agent Soybean Milk STI or natural Whitening Agent 1.0 0 0-15 extract Compound I Whitening Agent 0 0.25 0-1 - To prepare this formulation, the Disodium EDTA, sodium metabisulfite and ascorbic acid were slowly added to the water or to the soybean milk and stir until completely dissolved. STI, natural extracts or Compound I were then added and mixed slowly for five minutes. The speed of agitation was then increased and carbopol was added. The composition was mixed for 30 minutes or until the dispersion was free of “fish eyes”, which are non-dispersed clear lumps, and heated to 50° C. In a separate container, the slurry phase was prepared by combining Octoxynol-13,2,4-Hexadienoic acid, and Benzenemethanol and stirring ten minutes at 40-50° C. The slurry was then added slowly to the aqueous phase, mixed, and cooled to 45° C. 20% sodium hydroxide solution was used to pH the composition to pH of 7.0 (range is 5.5-8.5). This was mixed to homogeneity using agitation or sweep vessel.
- An example of a depigmenting formulation containing solvent is presented in Table K. A formulation with STI, where STI could be replaced with any naturally-derived serine protease inhibitor, or with any naturally-derived extract or fraction thereof containing serine protease inhibitors, is described in
column 3 of Table K. A similar formulation with Compound I is presented incolumn 4 of Table K. Compound I in this composition could be replaced with similar compounds or with serine protease inhibitor or with any PAR-2 inhibitor materials having high therapeutic indices, whether derived synthetically or naturally, as the active ingredient. Suggested ranges for the ingredients in such formulations are also listed in Table K. The deionized water content of these formulations could be replaced with soybean milk -
TABLE K CTFA Name Function % W/W Range Ethanol Solvent (1) 70 40-90 Propylene Glycol Solvent (2) 29 1-40 Deionized Water Carrier q.s. 1-40 STI Whitening Agent 0 Compound I Whitening Agent 1 μM .00001-1
To prepare this formulation Compound I was dissolved in water. The ethanol and propylene glycol were mixed and combined with the aqueous solution containing Compound I. - In summary, we have demonstrated that activation of the keratinocyte receptor PAR-2 results in increased pigmentation. Preferably, such activation may be accomplished by the use of trypsin or SLIGRL or SLIKOKVD or other SLTGRL or SLIGKVD derivatives. We have also demonstrated that whitening may be accomplished by the use of serine protease inhibitors or PAR-2 antagonists, as well as by melanosome-transfer blockers. Other compounds known to those of skill in the art that inhibit melanosome transfer into keratinocytes could also be used as depigmenting agents.
- Compound I, a trypsin and thrombin inhibitor, for example, inhibits melanosome transfer to keratinocytes. STI works by the same mechanism, The accumulation of undelivered melanosomes in the melanocytes could induce a negative feed back mechanism, that slows new melanosome formation. The production of TRP-1, the major glycoprotein in melanocytes, is down-regulated, which leads to destabilization of tyrosinase. This results in reduced melanin formation, and in a color switch to a lighter brown, as the ratio of TRP-1:TRP-2 is reduced. The melanosomes accumulation in the melanocyte after Compound I treatment, or after STI treatment, therefore, have reduced and altered melanin content, which adds to the whitening effect of compound I or STI.
Claims (5)
1-9. (canceled)
10. A method of effecting changes in mammalian skin pigmentation comprising administering to a mammal a pigmentation-changing effective amount of a compound which affects the PAR-2-pathway wherein said compound is a compound of formula I:
wherein:
A is selected from the group consisting of C1-alkyl, carboxyC1-4alkyl, C1-4alkoxycarbonylC1-4alkyl, phenylC1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents are independently selected from one or more of, C1-4 alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), formyl, C1-4alkoxycarbonyl, C1-2alkylcarbonyl, phenylC1-4alkoxycarbonyl, C3-7cycloakylcarbonyl, phenylcarbonyl, substituted phenylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), C1-4alkylsulfonyl, C1-4alkoxysulfonyl, perfluoroC1-4alkyl-sulfonyl, phenylsulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl, 10camphorsulfonyl, phenyl C1-4alkysulfonyl, substituted phenyl C1-4alkysulfonyl, C1-4alkylsulfinyl, perfluoroC1-4alkylsulfinyl, phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), phenyl1C1-4alkylsulfinyl, substituted pheny1C1-4alkylsulfinyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl or substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of; C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, carboxy or C1-4alkoxy-carbonyl), 1-naphthylsulfinyl, 2-naphthylsulfinyl or substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); a D or L amino acid which is coupled as its carboxy terminus to the nitrogen depicted in formula I and is selected from the group consisting of alanine, asparagine, 2-azetidinecarboxylic acid, glycine, N—C1-8alkyglycine, proline, 1-amino-1-cycloC1-8alkylcarboxylic acid, thiazzolidine-4-carboxylic acid, 5,5-dimethylthiazolidine-4-carboxylic acid, oxadolidine-4-carboxylic acid, pipecolinic acid, valine, methionine, cysteine, serine, threonine, norleucine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalamine, 2-thienylalanine, 3-thienylalanine, [1,2,3,4]-tetrahydroisoquinoline-1-carboxylic acid and 1,2,3,4,1-tetrahydroisoquinoline-2-caroboxylic acid
where the amino terminus of said amino acid is connected to a member selected form the group consisting of C1-4-alkyl,tetrazol-5yl-C1-2alkyl, carboxyC1-4alkyl, C1-4alkoxycarbony1C1-4alkyl, phenylC1-4alkyl, substituted phenyl C1-4 alkyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboy or C1-4alkoxycarbonyl), 1,1-diphenyl C1-4alkyl, 3phenyl-2-hydroxypropionyl, 2,2-diphenyl-1-hydroxyerthylcarbonyl, [1,2,3,4]-tetrahydroisoquinoline-1-carbonyl, [1,2,3,4]-tetrahydroisoquinoline-3,carbonyl, 1-methylamino-1-cyclohexanecarbonyl, 1-hydroxy-1-cyclohexanecarbonyl, 1-hydroxy-1-pheny-lacetyl, 1-cyclohexyl-1-hydroxyacetyl, 3-phenyl2-hydroxypropionyl, 3,3diphenyl-2-hydroxypropionyl, 3-cyclohexyl-2-hydroxypropionyl, formyl, C1-4alkoxycarbonyl, C1-12alkylcarbonyl, perfluoroC1-4alkyl, C1-4alkylcarbonyl, phenylC1-4alkylcarbonl, substituted phenylC1-4alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1diphenylC1-4alkylcarbonyl, substituted 1,1-diphenylC1-4-alkylcarbonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbanyl), perfluoroC1-4alkysulfonyl, C1-4alkysulfonyl, C1-4alkoxysulfonyl, phenysulfonyl, substituted phenylsulfonyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alklamino, C1-4dialkylamino, carboxy or C1-4alkoxcarbonyl), 10 camphorsulfonyl, phenylC1-4alkylsulfonyl, substituted phenyl C1-4alkylsulfonyl, perfluoroC1-4alkysulfinyl, C1-4alkysulfinyl, phenylsulfinyl, substituted phenysulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4 alkylamino, C1-4dialkylamino, carboxy or C1-4 alkoxycarbonyl), 1-naphthysulfonl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-58-4alkoxycarbonyl),1-naphthysulfinyl, 2-naphthysulfinyl, and substituted naphthylsulfinyl (where the naphthyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl): or a poly peptide comprised of two amino acids,
where the first amino acid is a D or L amino acid, bound via its carboxy terminus to the nitrogen depicted in Formula I and is selected from the group consisting of glycine, N—C1-8alkylglycine, alanine, 2-azetidinecarboxylic acid, proline, thiazolidine-4-carboxyliic acid, 5,5 dimethylthiazolidine-4-carboxylic acid, oxazolidine-4-carboxylic acid, 1-amino-1-cycloC3-8alkylcarboxylic acid, 3-hydroxypropoline, 4-hydroxyproline, 3-(C1-4alkoxy)proline, 4(C1-4alkoxy) proline, 3,4-dehydroprline, 2,2-dimethyl-4-thiazolidine carboxylic acid, 2,2-dimethyl-4-oxadolidine carboxylic acid, pipecolinic acid, valine, methionine, cysteine, asparagine, serine, threonine, leucine, tert-leucine, isoleucine, phenylalanine, 1-naphthalanine, 2-naphthalanine, 2-thienylalanine, 3thienylalnine, [1,2,3,4]-tetrahydroisoquinoline-2-carboxylic acid, aspartic acid-4-C1-4alkyl ester and glutamic acid 5-C1-4alkyl ester and the second D or L amino acid, is bound to the amino terminus of said first amino acid, and is selected from the group consisting of phenylalanine, 4-benzolyphenylalanine, 4-carboxyphenylalanine, 4-(Carboxy C1-2alkyl)phenylalanine, substituted phenylalanine (where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy C1-4dialkylamino, carboxy- or C1-4alkoxycarbonyl), 3-benzothienylalanine, 4biphenylalanine, homophenylalanine, octahydroindole-2-carboxylic acid, 2-Pyridylalanine, 3-pyridylalanine, 4-thiazolyalanine, 2-thienylalanine, 3-(3-benzothienyl) alanine, 3-thienylalanine, tryptophan, tyrosine, asparagine, 3-triC1-4alkylsilylalanine, cyclohexylglycine diphenylglycine, phenylglycine, methionine sulfoxide, methionine sulfone, 2,2-dicyclohexylalanine, 2-(1naphthylalanine), 2-(2-naphthylalanine), phenyl substituted phenylalanine (where the substituents are selected from C1-4(alkyl, perfluoro C1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialylamino, carboxy or C1-4alkoxycarbonyl), aspartic acid, aspartic acid4C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbony), aspartic acid, aspartic acid-4-C1-4alkyl ester glutamic acid, glutamic acid-5-C1-4 alkyl ester, cycloC3-salkylaalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4alkyl ester, cycloC3-8alkylalanine, substituted cycloC3-8alkylalanine (where the ring substituents are carboxy, C1-4alkylcarboxy, C1-4alkoxcarbonyl or aminocarbonyl), 2,2-diphenylalanine and all alpha-C1-5alkyl of all amino acid derivatives thereof, where the amino terminus of said second amino acid is unsubstituted or monosubstituted with a member of the group consisting of formyl, C1-12alkyl, tetrazol-5-y1C1-2alkyl, carboxyC1-8, alkyl, carboalkoxyC1-4alkyl, phenyl C1-4alkyl, substituted phenylC1-4alkyl (where the phenyl substituents or independently selected from one or more of C1-4alkyl, perfluoroC1-4alkyl, C1-4-alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4, dialkylamino, carboxy or C1-4alkoxycarbonyl), 1,1-dipheny1C1-4alkyl, C1-6alkoxycarbonyl, phenylC1-6alkoxycarbonyl, C1-2alkylcarbonyl, perfluoroC1-4alkylC1-4alkylcarbonyl, phenyC1-4alkylcarbonyl, substituted phenyC1-4alkylcarbonyl(where the phenyl substituents are independently selected from one or more of C1-4alkyl, perfluoro C1-4alkyl, C1-4 alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl) 1,1-diphenylC1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxycarbonyl), 10-camphorsulfonyl, phenylC1-4alkysulfonyl, substituted phenyl C1-4alkylsulfonyl, C1-4alkysulfinyl, pertfluoro C1-4alkylsulfinyl phenylsulfinyl, substituted phenylsulfinyl (where the phenyl substituents are independently selected from one or more of, C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamono, C1-4dialkylamono, carboxy or C1-4alkoxycarbonyl), phenyC1-4alkylsulfinyl, substituted phenylC1-4alkylsulfinyl l-naphthylsulfonyl, 2-naphthylsulfonyl, substituted naphthylsulfonyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl;), 1-naphthyl-sulfinyl, 2naphthylsulfinyl and substituted naphthylsulfinyl (where the naphthyl substituent is selected from C1-4alkyl, perfluoroC1-4alkyl, C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4dialkylamino, carboxy or C1-4alkoxycarbonyl); R1 is selected from the group consisting of hydrogen and alkyl; R2 is selected from the group consisting of aminoC2-5, alkyl, guanidinoC2-5alkyl, C1-4alkylguanidinoC2-5alkyl, diC1-4alkylguanidinoC2-5alkyl, amidinoC2-5alkyl, C1-4alky-lamidinoC2-5alkyl, diC1-4alky-lamidinoC2-5alkyl, C1-3alkoxyC2-5alkyl, phenyl, substituted phenyl (where the substituents are independently selected from one or more of amino, amidino, guanidino, C1-4alkylamino, C1-4dialkylamino, halogen, perfluoro C1-4alkyl, C1-3alkyl, C1-3alkoxy or nitro), benzyl, phenyl substituted benzyl (where the substituents are independently selected from one or more of, amino, amidino, guanidino, C1-4alkylamino, C1-4dialky-lamino, halogen, pertfluoro C1-4alkyl, C1-04alkyl, C1-3alkoxy or nitro), hydroxyC2-5alkyl, C1-5alkylaminoC2-5 alkyl, C2-5dialklaminoC2-5alkyl, 4-aminiocyclohexylCO-2alkyl and C1-5alkyl;
p is 0 or 1:
B is
where n is 0-3, R, is H or C1-Saikyl and the carbonyl moiety of B is bound to E; E is a heterocycle selected from the group consisting of oxazolin-2-yl, oxazol-2-yl thiazol-2-yl, thiazol-5-yl, thiazol-4-yl, thiazolin-2-yl, imidazol-2-yl, 4-oxo-2quinoxalin-2-yl, 2pyridyl, 3-pyridyl, benzo(b)thiophen-2-yl, triazol-4-yl triazol-6-yl, pyrazol-2-yl, 4,5,6,7-tetrahydrobenzothiazol-2yl, naphtho[2,1-dlthiazol-2-yl, naphtho[1-2-dlthiazoi-2-yl quinoxalin-2-yl, isoquinclin-1-yl, isoquinolin-3-yl, benzo [blfuran-2-yl [pyrazin-2-yl, quinazoiin-2-yl, isothiazol-5-yl, isothiazol-3yl, purin-8yul and a substituted heterocycle where the substituents are selected from C1-4alkyl, perfluoro C1-4alkyl C1-4alkoxy, hydroxy, halo, amido, nitro, amino, C1-4alkylamino, C1-4 dialkylamino, carboxy, C1-4alkoxycarbonyl, hydroxy or phenylC1-4alkylaminocarbonyl; or pharmaceutically acceptable salts thereof.
10. A method according to claim 9 wherein said compound contains a d-phenylalanine-proline-arginine sequence.
11. A method according to claim 10 wherein said compound is (S)-N-Methyl-D-phenylalanyl-N-[4-[(aminoiminomethyl)aminol-1-(2-benzothiazolylcarbonyl)butyl-L-prolinamide.
12-68. (canceled)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/929,488 US20080249029A1 (en) | 1997-07-28 | 2007-10-30 | Methods for Treating Skin Pigmentation |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US5394297P | 1997-07-28 | 1997-07-28 | |
US8044198P | 1998-04-02 | 1998-04-02 | |
US09/110,409 US8039026B1 (en) | 1997-07-28 | 1998-07-06 | Methods for treating skin pigmentation |
US11/929,488 US20080249029A1 (en) | 1997-07-28 | 2007-10-30 | Methods for Treating Skin Pigmentation |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/110,409 Division US8039026B1 (en) | 1997-07-28 | 1998-07-06 | Methods for treating skin pigmentation |
Publications (1)
Publication Number | Publication Date |
---|---|
US20080249029A1 true US20080249029A1 (en) | 2008-10-09 |
Family
ID=27368528
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/110,409 Expired - Fee Related US8039026B1 (en) | 1997-07-28 | 1998-07-06 | Methods for treating skin pigmentation |
US11/929,488 Abandoned US20080249029A1 (en) | 1997-07-28 | 2007-10-30 | Methods for Treating Skin Pigmentation |
US13/183,913 Abandoned US20120027706A1 (en) | 1997-07-28 | 2011-07-15 | Methods for treating skin pigmentation |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/110,409 Expired - Fee Related US8039026B1 (en) | 1997-07-28 | 1998-07-06 | Methods for treating skin pigmentation |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/183,913 Abandoned US20120027706A1 (en) | 1997-07-28 | 2011-07-15 | Methods for treating skin pigmentation |
Country Status (20)
Country | Link |
---|---|
US (3) | US8039026B1 (en) |
EP (1) | EP0948308B1 (en) |
JP (2) | JP4401441B2 (en) |
KR (1) | KR100691395B1 (en) |
CN (1) | CN1234735B (en) |
AR (1) | AR016780A1 (en) |
AT (1) | ATE260083T1 (en) |
AU (1) | AU8756698A (en) |
BR (2) | BR9806118A (en) |
CA (1) | CA2267077C (en) |
DE (1) | DE69821913T2 (en) |
DK (1) | DK0948308T3 (en) |
ES (1) | ES2215317T3 (en) |
HU (1) | HUP0000216A3 (en) |
ID (1) | ID22061A (en) |
IL (1) | IL129090A0 (en) |
PL (1) | PL333284A1 (en) |
PT (1) | PT948308E (en) |
TW (1) | TW557216B (en) |
WO (1) | WO1999004752A2 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110081305A1 (en) * | 2009-10-02 | 2011-04-07 | Steven Cochran | Compositions comprising a skin-lightening resorcinol and a skin darkening agent |
US9289361B2 (en) | 2009-10-02 | 2016-03-22 | Johnson & Johnson Consumer Inc. | Compositions comprising an NFκB-inhibitor and a non-retinoid collagen promoter |
US9370474B2 (en) | 2009-10-02 | 2016-06-21 | Johnson & Johnson Consumer Inc. | High-clarity aqueous concentrates of 4-hexylresorcinol |
US9375395B2 (en) | 2009-10-02 | 2016-06-28 | Johnson & Johnson Consumer Inc. | Compositions comprising an NFκB-inhibitor and a tropoelastin promoter |
WO2018162645A1 (en) | 2017-03-08 | 2018-09-13 | Amazentis Sa | Skin treatment methods |
US10307352B2 (en) | 2012-09-24 | 2019-06-04 | Johnson & Johnson Consumer Inc. | Low oil compositions comprising a 4-substituted resorcinol and a high carbon chain ester |
Families Citing this family (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8039026B1 (en) | 1997-07-28 | 2011-10-18 | Johnson & Johnson Consumer Companies, Inc | Methods for treating skin pigmentation |
US8106094B2 (en) | 1998-07-06 | 2012-01-31 | Johnson & Johnson Consumer Companies, Inc. | Compositions and methods for treating skin conditions |
US8093293B2 (en) | 1998-07-06 | 2012-01-10 | Johnson & Johnson Consumer Companies, Inc. | Methods for treating skin conditions |
US6750229B2 (en) * | 1998-07-06 | 2004-06-15 | Johnson & Johnson Consumer Companies, Inc. | Methods for treating skin pigmentation |
BR0007778A (en) | 1999-01-27 | 2002-06-04 | Ortho Mcneil Pharm Inc | Peptidyl heterocyclic ketones useful as tryptase inhibitors |
US20020034772A1 (en) | 1999-06-29 | 2002-03-21 | Orlow Seth J. | Methods and compositions that affect melanogenesis |
US7985404B1 (en) | 1999-07-27 | 2011-07-26 | Johnson & Johnson Consumer Companies, Inc. | Reducing hair growth, hair follicle and hair shaft size and hair pigmentation |
BR0007404A (en) * | 1999-11-05 | 2002-04-09 | Johnson & Johnson Consumer | Soy compositions for depigmentation and skin care |
AU2012216795B2 (en) * | 1999-11-05 | 2015-07-09 | Johnson & Johnson Consumer Companies, Inc. | Soy depigmenting and skin care compositions |
US8431550B2 (en) * | 2000-10-27 | 2013-04-30 | Johnson & Johnson Consumer Companies, Inc. | Topical anti-cancer compositions and methods of use thereof |
US7192615B2 (en) * | 2001-02-28 | 2007-03-20 | J&J Consumer Companies, Inc. | Compositions containing legume products |
US6555143B2 (en) * | 2001-02-28 | 2003-04-29 | Johnson & Johnson Consumer Products, Inc. | Legume products |
US7025951B2 (en) | 2002-06-18 | 2006-04-11 | Johnson & Johnson Consumer Companies, Inc. | Compositions and methods for darkening the skin |
KR101156968B1 (en) * | 2002-12-02 | 2012-06-20 | 포라 가세이 고교 가부시키가이샤 | Dendrite elongation inhibitor for melanocyte and skin preparation for external use containing the same |
JP4447466B2 (en) * | 2002-12-03 | 2010-04-07 | ポーラ化成工業株式会社 | Melanocyte dendrite elongation inhibitor and skin external preparation containing the same |
US9084734B2 (en) * | 2005-05-05 | 2015-07-21 | Danisco Us Inc. | Peptide personal care compositions and methods for their use |
FR2889808B1 (en) | 2005-08-17 | 2011-07-22 | Oreal | USE OF 8-HEXADECENE-1,16-DICARBOXYLIC ACID AS A CARE AGENT TO PROMOTE COHESION OF THE CORNEA LAYER |
JP5568008B2 (en) * | 2007-06-27 | 2014-08-06 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Peptide tyrosinase inhibitors and uses thereof |
JP2010160145A (en) * | 2008-12-12 | 2010-07-22 | Daiichi Sankyo Healthcare Co Ltd | Method for detecting melanosome transport |
US9326930B2 (en) | 2009-01-16 | 2016-05-03 | Neocutis S.A. | Calcium sequestration compositions and methods of treating skin pigmentation disorders and conditions |
KR101286152B1 (en) * | 2010-12-17 | 2013-07-15 | 계명대학교 산학협력단 | Composition for Improving Vitiligo or Canities Comprising Extract from Glycine maxim As Active Ingredient |
AU2012331140A1 (en) | 2011-11-04 | 2014-05-08 | Lipotec, S.A. | Peptides which inhibit activated receptors and their use in cosmetic or pharmaceutical compositions |
JP2014153878A (en) * | 2013-02-07 | 2014-08-25 | Nippon Telegr & Teleph Corp <Ntt> | End-end personal identity guarantee system and method |
JP6324777B2 (en) * | 2014-03-18 | 2018-05-16 | ポーラ化成工業株式会社 | Collagen production promoter |
EP3200683A4 (en) * | 2014-09-29 | 2018-03-21 | ELC Management LLC | Actives for stimulating differentiation of keratinocytes to lighten hyperpigmented skin |
SG11201805765QA (en) | 2016-01-19 | 2018-08-30 | Achromaz Pte Ltd | A cosmetic composition and the use thereof for regulating skin quality |
CN106619167A (en) * | 2016-11-25 | 2017-05-10 | 南京泛成生物化工有限公司 | Composition capable of whitening and brightening, preparation method thereof and application thereof in cosmetics |
WO2021037759A1 (en) | 2019-08-28 | 2021-03-04 | Unilever Global Ip Limited | Novel compounds for skin lightening |
US20220313581A1 (en) | 2019-08-28 | 2022-10-06 | Conopco, Inc. , d/b/a UNILEVER | Novel compounds for skin lightening |
Citations (96)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2876164A (en) * | 1957-08-01 | 1959-03-03 | Dome Chemicals Inc | Dermatological preparation containing defatted soy bean flour |
US2924525A (en) * | 1957-06-03 | 1960-02-09 | Central Soya Co | Poultry treatment for skin pigmentation |
US4007266A (en) * | 1968-05-03 | 1977-02-08 | Choay S.A. | Pharmaceutical composition containing vitamin B12, process of making the same and method of treatment |
US4151304A (en) * | 1976-11-05 | 1979-04-24 | Lever Brothers Company | Method and composition for moisturizing the skin |
US4190671A (en) * | 1977-03-17 | 1980-02-26 | Biorex Laboratories Limited | Chalcone derivatives |
US4254105A (en) * | 1975-10-11 | 1981-03-03 | The Lion Dentifrice Co., Ltd. | Multiple emulsion having a form of water/oil/water phase and process for preparation thereof, and multiple emulsion type cosmetics |
US4331692A (en) * | 1971-07-23 | 1982-05-25 | Ulla Drevici | Cocoa fruits and products |
US4368187A (en) * | 1981-08-03 | 1983-01-11 | Eli Lilly And Company | Sensitive-skin care regime |
US4370315A (en) * | 1977-02-22 | 1983-01-25 | Sederma | Post-depilatory composition reducing progressively the growth of body hair |
US4382960A (en) * | 1981-08-03 | 1983-05-10 | Eli Lilly And Company | Cosmetic cleanser formulation |
US4386067A (en) * | 1969-04-30 | 1983-05-31 | Expanscience | Cosmetic compositions |
US4427670A (en) * | 1980-03-27 | 1984-01-24 | Mitsubishi Chemical Industries Limited | Skin preparation |
US4434095A (en) * | 1979-02-04 | 1984-02-28 | Institute Organicheskogo Sinteza | Cyclic analogue of naturally-occurring phagocytosis-stimulant peptide - threonyl-cyclo-[-N.sup.ε -lysyl-prolyl-arginyl] |
US4437895A (en) * | 1981-07-23 | 1984-03-20 | Societe Anonyme Dite: L'oreal | Mixture of vegetable oils based on jojoba oil and cosmetic compositions comprising the mixture |
US4439418A (en) * | 1981-07-29 | 1984-03-27 | Henkel Kgaa | Topical preparations for the treatment of seborrhea and process for inhibiting sebum production |
US4512973A (en) * | 1983-10-12 | 1985-04-23 | Genentech, Inc. | Method for overcoming trypsin inhibition |
US4515778A (en) * | 1981-03-12 | 1985-05-07 | Wolfgang Kastell | Preparation for conditioning and grooming the hair |
US4578267A (en) * | 1981-09-15 | 1986-03-25 | Morton Thiokol, Inc. | Skin conditioning polymer containing alkoxylated nitrogen salts of sulfonic acid |
US4584190A (en) * | 1983-11-17 | 1986-04-22 | Kao Corporation | Novel chalcone derivatives and ultraviolet absorbers comprising the same |
US4727088A (en) * | 1984-02-06 | 1988-02-23 | Neutrogena Corporation | Retinoid composition having enhanced bioavailability and percutaneous absorption |
US4824662A (en) * | 1987-06-15 | 1989-04-25 | Vi-Jon Laboratories, Inc. | Nail polish remover |
US4834076A (en) * | 1985-04-17 | 1989-05-30 | Millet Jean M | Device for treating the external human epithelium, process for its manufacture and process for using such a device |
US4895839A (en) * | 1987-07-10 | 1990-01-23 | INDENZA S.p.A. | Pharmaceutical and cosmetic compositions containing complexes of flavanolignans with phospholipids |
US4906457A (en) * | 1988-09-06 | 1990-03-06 | Washington State University Research Foundation, Inc. | Compositions and methods for reducing the risk of sunlight and ultraviolet induced skin cancer |
US5002761A (en) * | 1988-05-02 | 1991-03-26 | Henkel Kommanditgesellschaft Auf Aktien | Hair treatment compositions containing natural ingredients |
US5006337A (en) * | 1987-04-16 | 1991-04-09 | Marbert Gmbh | Medicinal compositions based on spent brewers' grains extract, a process for the preparation thereof, and the use of spent brewers' grains extract for the preparation of cosmetic compositions, and a special brewers' grains extract |
US5104655A (en) * | 1987-07-27 | 1992-04-14 | Indena S.P.A. | Polyunsaturated acids having vasokinetic action and pharmaceutical and cosmetic formulations containing them |
US5110603A (en) * | 1991-01-31 | 1992-05-05 | Kao Corporation | Bathing preparation for colloidal material |
US5179091A (en) * | 1990-06-22 | 1993-01-12 | Adir Et Compagnie | Chalcones |
US5188823A (en) * | 1991-02-07 | 1993-02-23 | Stepan Company | Antiperspirant formulations |
US5192332A (en) * | 1983-10-14 | 1993-03-09 | L'oreal | Cosmetic temporary coloring compositions containing protein derivatives |
US5194252A (en) * | 1989-07-27 | 1993-03-16 | Vijon Laboratories, Inc. | Moisture retaining aftershave |
US5276058A (en) * | 1993-06-09 | 1994-01-04 | Nippon Hypox Laboratories Incorporated | 3,4-dihydroxychalcone derivatives |
US5306444A (en) * | 1990-08-24 | 1994-04-26 | Shiseido Company Ltd. | Washing composition capable of preventing and ameliorating skin irritation |
US5393519A (en) * | 1992-03-27 | 1995-02-28 | Helene Curtis, Inc. | Shampoo compositions |
US5397497A (en) * | 1992-08-07 | 1995-03-14 | Solvay Fluor Und Derivate Gmbh | Bath additive composition containing polyglycerol fatty acid ester mixture |
US5407675A (en) * | 1990-08-10 | 1995-04-18 | Etemad-Moghadam; Parviz | Method and composition for use on the scalp and eyebrow region of a subject |
US5498420A (en) * | 1991-04-12 | 1996-03-12 | Merz & Co. Gmbh & Co. | Stable small particle liposome preparations, their production and use in topical cosmetic, and pharmaceutical compositions |
US5503832A (en) * | 1994-02-15 | 1996-04-02 | De Stoutz; Jean-Christian | Method for extracting the soluble material from oil-bearing beans or seeds |
US5505946A (en) * | 1994-04-01 | 1996-04-09 | Trustees Of Univ Of Pa | Bowman-birk inhibitor concentrate compositions and methods for the treatment of pre-malignant tissue |
US5510391A (en) * | 1993-10-22 | 1996-04-23 | Mayapple Holdings, Llc | Method of treating blood vessel disorders of the skin using vitamin K |
US5595984A (en) * | 1991-11-25 | 1997-01-21 | Richardson-Vicks Inc. | Use of salicylic acid for regulating skin wrinkles and/or skin atrophy |
US5601833A (en) * | 1993-12-30 | 1997-02-11 | L'oreal | Protective, nutritive and/or firming composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof |
US5603949A (en) * | 1991-08-01 | 1997-02-18 | Lvmh Recherche | Use of a tocopherol phosphate or one of its derivatives, for the preparation of cosmetic or pharmaceutical compositions and compositions so obtained |
US5605894A (en) * | 1991-11-25 | 1997-02-25 | Richardson-Vicks Inc. | Compositions for regulating skin wrinkles and/or skin atrophy |
US5607666A (en) * | 1993-12-22 | 1997-03-04 | L'oreal | Cosmetic or dermatological powder, its preparation process and its uses |
US5607692A (en) * | 1993-12-30 | 1997-03-04 | L'oreal | Depigmenting composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof |
US5614180A (en) * | 1993-08-30 | 1997-03-25 | Helene Curtis, Inc. | Shampoo-conditioner composition |
US5614215A (en) * | 1993-12-30 | 1997-03-25 | L'oreal | Cosmetic composition for the simultaneous treatment of the surface and deep layers of the skin, its use |
US5618522A (en) * | 1995-01-20 | 1997-04-08 | The Procter & Gamble Company | Emulsion compositions |
US5620692A (en) * | 1993-12-23 | 1997-04-15 | Nurture, Inc. | Oat oil compositions with useful cosmetic and dermatological properties |
US5712356A (en) * | 1993-11-26 | 1998-01-27 | Ciba Vision Corporation | Cross-linkable copolymers and hydrogels |
US5723148A (en) * | 1995-01-05 | 1998-03-03 | Novartis Corp. | Topical pharmaceutical compositions |
US5741496A (en) * | 1993-09-21 | 1998-04-21 | Laboratoires De Biologie Vegetale Yves Rocher | Process for the treatment of skins having dry areas and greasy areas |
US5863546A (en) * | 1997-03-02 | 1999-01-26 | Swinehart; James M | Cosmetic composition |
US5869031A (en) * | 1995-03-23 | 1999-02-09 | Pierre Fabre Dermo-Cosmetique | Depigmenting dermatological and/or cosmetic composition |
US5871823A (en) * | 1996-06-19 | 1999-02-16 | Huels Aktiengesellschaft | Hydrophilic coating of surfaces of polymeric substrates |
US5871743A (en) * | 1996-10-31 | 1999-02-16 | Chajuss; Daniel | Topical application of soy molasses |
US5880314A (en) * | 1995-11-24 | 1999-03-09 | Mitsui Chemicals, Inc. | Hydrochalcone derivatives, cosmetic compositions containing said derivatives and methods of producing the same |
US5885593A (en) * | 1995-09-28 | 1999-03-23 | The Andrew Jergens Company | Skin care composition including cyclodextrin materials and method for treating skin therewith |
US5885600A (en) * | 1997-04-01 | 1999-03-23 | Burlington Bio-Medical & Scientific Corp. | Natural insect repellent formula and method of making same |
US5885617A (en) * | 1994-07-12 | 1999-03-23 | Bpsi Holdings, Inc. | Moisture barrier film coating composition, method, and coated form |
US5885948A (en) * | 1995-02-15 | 1999-03-23 | The Procter & Gamble Company | Crystalline hydroxy waxes as oil in water stabilizers for skin cleansing liquid composition |
US5885596A (en) * | 1997-07-23 | 1999-03-23 | Bristol-Myers Squibb Company | Methods and compositions for fine lines and/or wrinkles |
US5888522A (en) * | 1996-08-23 | 1999-03-30 | Skin Biology, Inc. | Tissue protective and regenerative compositions |
US6013250A (en) * | 1995-06-28 | 2000-01-11 | L'oreal S. A. | Composition for treating hair against chemical and photo damage |
US6013255A (en) * | 1994-04-18 | 2000-01-11 | Gist-Brocades B.V. | Stable water-in-oil emulsions |
US6018001A (en) * | 1997-01-23 | 2000-01-25 | Menicon Co., Ltd. | Process for producing contact lens with hydrophilic surface and contact lens obtained thereby |
US6017549A (en) * | 1997-09-30 | 2000-01-25 | E-L Management Corp. | Non-irritating cosmetic and pharmaceutical compositions |
US6017893A (en) * | 1997-08-29 | 2000-01-25 | Natures Sunshine Products, Inc. | Use of isoflavones to prevent hair loss and preserve the integrity of existing hair |
US6019962A (en) * | 1995-11-07 | 2000-02-01 | The Procter & Gamble Co. | Compositions and methods for improving cosmetic products |
US6030931A (en) * | 1998-02-03 | 2000-02-29 | Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. | Foaming cleansing skin product |
US6033680A (en) * | 1994-12-06 | 2000-03-07 | The Procter & Gamble Company | Shelf stable skin cleansing liquid with gel forming polymer and lipid |
US6045779A (en) * | 1994-02-18 | 2000-04-04 | Henkel Kommanditgesellschaft Auf Aktien | Skin and hair aerosol foam preparations containing an alkyl polyglycoside and vegetable oil |
US6048520A (en) * | 1992-09-24 | 2000-04-11 | Helene Curtis, Inc. | Clear leave-on hair treatment composition and method |
US6051602A (en) * | 1998-03-16 | 2000-04-18 | The Procter & Gamble Company | Methods for regulating skin appearance |
US6054137A (en) * | 1997-12-19 | 2000-04-25 | Societe L'oreal S.A. | Promoting epidermal renewal with phloroglucinol |
US6180662B1 (en) * | 1994-12-13 | 2001-01-30 | Beiersdorf Ag | Agents acting against hyperreactive and hypoactive, deficient skin conditions and manifest dermatitides |
US6183762B1 (en) * | 1997-05-27 | 2001-02-06 | Sembiosys Genetics Inc. | Oil body based personal care products |
US6183761B1 (en) * | 1998-03-16 | 2001-02-06 | The Procter & Gamble Company | Compositions for regulating skin appearance |
US20020035046A1 (en) * | 1999-07-01 | 2002-03-21 | Lukenbach Elvin R. | Personal care compositions |
US20020034489A1 (en) * | 1999-06-10 | 2002-03-21 | Benjamin Wiegland | Personal care formulations |
US20030064048A1 (en) * | 1999-07-27 | 2003-04-03 | Miri Seiberg | Reducing hair growth, hair follicle and hair shaft size and hair pigmentation |
US20030064049A1 (en) * | 2000-10-27 | 2003-04-03 | Miri Seiberg | Topical anti-cancer compositions and methods of use thereof |
US6551606B1 (en) * | 1999-06-10 | 2003-04-22 | Coty B.V. | Cosmetic product containing enzymes |
US6555143B2 (en) * | 2001-02-28 | 2003-04-29 | Johnson & Johnson Consumer Products, Inc. | Legume products |
US20040009142A1 (en) * | 2000-07-26 | 2004-01-15 | Marie-France Zambaux | Synergistically active mixture which inhibits hair growth |
US20040062731A1 (en) * | 2000-10-27 | 2004-04-01 | Miri Seiberg | Topical anti-cancer compositions and methods of use thereof |
US20040063593A1 (en) * | 2002-09-30 | 2004-04-01 | Wu Jeffrey M. | Compositions containing a cosmetically active organic acid and a legume product |
US20040067244A1 (en) * | 1999-03-22 | 2004-04-08 | Friedman Doron I. | Nano oil in glycerin emulsion |
US20050004561A1 (en) * | 2003-07-01 | 2005-01-06 | Lynn Halas | Method for removing hair |
US20050008665A1 (en) * | 2001-10-13 | 2005-01-13 | Beiersdorf Ag | Cosmetic or dermatological active ingredient combination |
US20050019279A1 (en) * | 2001-11-09 | 2005-01-27 | Beiersdorf Ag | Cosmetic or dermatological preparation containing an octadecene dioic acid and a UV filtering substance |
US20050036963A1 (en) * | 1998-07-06 | 2005-02-17 | Archana Sah | Compositions and methods for treating skin conditions |
US20070009459A1 (en) * | 2003-08-26 | 2007-01-11 | Stephanie Magnant | Stabilized antiperspirant compositions containing soy products |
US20070041931A1 (en) * | 2003-10-29 | 2007-02-22 | Muriel Morelli | Compositions Comprising Soy Products and Dioic Acids |
Family Cites Families (270)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3097947A (en) | 1961-01-30 | 1963-07-16 | Mend Johnson & Company | Nutritional composition and process |
US3395214A (en) | 1964-01-09 | 1968-07-30 | Scholl Mfg Co Inc | Antiperspirant composition providing a readily collapsible sprayable foam |
US3625976A (en) | 1969-12-09 | 1971-12-07 | Int Flavors & Fragrances Inc | Coumarin ether sun-screening compounds |
US3755560A (en) | 1971-06-30 | 1973-08-28 | Dow Chemical Co | Nongreasy cosmetic lotions |
US4056637A (en) | 1976-06-08 | 1977-11-01 | Japan Natural Food Co. Ltd. | Process for preparing food products containing a lactic acid bacteria-fermented product of a cereal germ |
US4279930A (en) | 1978-10-10 | 1981-07-21 | The Upjohn Company | Process for treating inflammation |
US4219569A (en) | 1978-10-10 | 1980-08-26 | The Upjohn Company | Process for treating inflammation |
US4223018A (en) | 1979-02-09 | 1980-09-16 | Jimmie Belle | Bath composition |
DE3040246C2 (en) | 1979-10-29 | 1985-01-10 | Osaka Chemical Laboratory Co., Ltd., Osaka | Soy Saponins A ↓ 1 ↓ and A? 2? and their use |
US4297348A (en) | 1980-04-11 | 1981-10-27 | Rush-Hampton Industries, Inc. | Composition and method for the treatment of acne |
US5439672A (en) | 1980-07-01 | 1995-08-08 | L'oreal | Cosmetic composition based on an aqueous dispersion of small lipid spheres |
US4272544A (en) | 1980-08-20 | 1981-06-09 | Eli Lilly And Company | Skin cell renewal regime |
US4278570A (en) | 1980-08-20 | 1981-07-14 | Eli Lilly And Company | Cosmetic cleanser formulation |
LU83020A1 (en) | 1980-12-19 | 1982-07-07 | Oreal | OIL COMPOSITION FOR THE TREATMENT OF KERATINIC MATERIALS AND THE SKIN |
US4603146A (en) | 1984-05-16 | 1986-07-29 | Kligman Albert M | Methods for retarding the effects of aging of the skin |
US4859458A (en) | 1981-09-15 | 1989-08-22 | Morton Thiokol, Inc. | Hair conditioning polymers containing alkoxylated nitrogen salts of sulfonic acid |
US4421769A (en) | 1981-09-29 | 1983-12-20 | The Procter & Gamble Company | Skin conditioning composition |
FR2514643B1 (en) | 1981-10-20 | 1986-07-04 | Oreal | COPPER LANOLATE AND ANTI-ACNE COSMETIC COMPOSITIONS CONTAINING THE SAME |
FR2520253A1 (en) | 1982-01-28 | 1983-07-29 | Oreal | NOVEL EMULSIFYING SYSTEM BASED ON PROTEIN CONDENSATION, POLYOXYETHYLENE STEROL AND PHOSPHATIDE AND USE THEREOF IN COSMETICS |
US4477434A (en) | 1982-05-29 | 1984-10-16 | Reiko Kosaka | Medicinal compositions, foods and beverages having therapeutic effects on diseases of circulatory system and digestive system |
US4462981A (en) | 1982-12-10 | 1984-07-31 | Creative Products Resource, Associates Ltd. | Cosmetic applicator useful for skin moisturizing and deodorizing |
US4550035A (en) | 1982-12-10 | 1985-10-29 | Creative Products Resource Associates, Ltd. | Cosmetic applicator useful for skin moisturizing and deodorizing |
US4604281A (en) | 1983-03-21 | 1986-08-05 | Charles Of The Ritz Group Ltd. | Cosmetic and skin treatment compositions containing acetylated sterols |
DE3326455A1 (en) | 1983-07-22 | 1985-01-31 | Henkel Kgaa | COSMETIC-PHARMACEUTICAL OIL COMPONENTS |
JPS6061513A (en) | 1983-09-14 | 1985-04-09 | Sansho Seiyaku Kk | Cosmetic |
IT1180156B (en) | 1984-01-09 | 1987-09-23 | Crinos Industria Farmaco | GLYCOPROTEIN-BASED COSMETIC COMPOSITION FOR SKIN TREATMENT |
US4690821A (en) | 1984-02-10 | 1987-09-01 | Creative Products Resource Associates, Ltd. | Towel for skin moisturizing and drying |
ATE81449T1 (en) | 1984-03-05 | 1992-10-15 | Tonfer Inc | CLEANING SUPPLIES. |
AU580645B2 (en) | 1984-12-21 | 1989-01-19 | Kibun Company Limited | Process of producing soy bean milk |
US4760096A (en) | 1985-09-27 | 1988-07-26 | Schering Corporation | Moisturizing skin preparation |
US4793991A (en) | 1986-01-31 | 1988-12-27 | Slimak Karen M | Hypoallergenic cosmetics, lip balms and lip sticks |
US4970216A (en) | 1986-03-17 | 1990-11-13 | Richardson Vicks, Inc. | Skin treatment composition and method |
US4847267A (en) | 1986-03-17 | 1989-07-11 | Charles Of The Ritz Group Ltd. | Skin treatment composition and method |
LU86361A1 (en) | 1986-03-19 | 1987-11-11 | Oreal | AQUEOUS COSMETIC COMPOSITION WITH DIFFERENT FOAM FOR THE TREATMENT OF HAIR AND SKIN |
FR2641696B2 (en) | 1986-04-11 | 1991-03-08 | Sederma Sa | USE OF A MIXTURE CONTAINING LACTOFERRIN IN FREE ANTI-RADICAL COSMETIC PREPARATIONS |
FR2596986B1 (en) | 1986-04-11 | 1988-09-23 | Sederma Sa | USE OF LACTOFERRIN IN COSMETIC, FREE ANTIRADICAL PREPARATIONS |
FR2600250B1 (en) | 1986-06-23 | 1989-11-24 | Bio Serae | PROCESS FOR PACKAGING AN ANTIBACTERIAL COMPOSITION AND PACKAGED ANTIBACTERIAL COMPOSITION |
JPS63135310A (en) | 1986-11-27 | 1988-06-07 | Lion Corp | Cosmetic |
LU86715A1 (en) | 1986-12-16 | 1988-07-14 | Oreal | COSMETIC COMPOSITION CONTAINING HYDROXYLATED CHALCON DERIVATIVES AND ITS USE FOR PROTECTING SKIN AND HAIR AGAINST LIGHT RADIATION, NEW HYDROXYLATED CHALCON DERIVATIVES AND THEIR PREPARATION METHOD |
AU618517B2 (en) | 1986-12-23 | 1992-01-02 | Eugene J. Van Scott | Additives enhancing topical actions of therapeutic agents |
IT1201149B (en) | 1987-01-14 | 1989-01-27 | Indena Spa | BIOFLAVONOID COMPLEXES WITH PHOSPHOLIPIDS, THEIR PREPARATION, USE AND PHARMACEUTICAL AND COSMETIC COMPOSITIONS |
US5166139A (en) | 1987-02-26 | 1992-11-24 | Indena, S.P.A. | Complexes of saponins and their aglycons with phospholipids and pharmaceutical and cosmetic compositions containing them |
IT1203515B (en) | 1987-02-26 | 1989-02-15 | Indena Spa | SAPONINE COMPLEXES WITH PHOSPHOLIPIDS AND PHARMACEUTICAL AND COSMETIC COMPOSITIONS CONTAINING THEM |
US4960764A (en) | 1987-03-06 | 1990-10-02 | Richardson-Vicks Inc. | Oil-in-water-in-silicone emulsion compositions |
US5688763A (en) | 1987-06-12 | 1997-11-18 | Hammonds, Jr.; R. Glenn | Compositions and methods for the synthesis of growth hormone receptor and growth hormone binding protein |
US5057417A (en) | 1987-06-12 | 1991-10-15 | Genentech, Inc. | Compositions and methods for the synthesis of growth hormone receptor and growth hormone binding protein |
LU86997A1 (en) | 1987-09-21 | 1989-04-06 | Oreal | PHOTOSTABLE FILTERING COSMETIC COMPOSITION CONTAINING BIXIN ASSOCIATED WITH A LIPOSOLUBLE UV FILTER AND ITS USE FOR THE PROTECTION OF THE HUMAN SKIN AGAINST ULTRAVIOLET RADIATION |
JP2618657B2 (en) | 1987-10-02 | 1997-06-11 | 株式会社資生堂 | External preparation for anti-pigmentation |
JPH0196106A (en) | 1987-10-09 | 1989-04-14 | Shiseido Co Ltd | External drug for skin |
US4915972A (en) * | 1988-01-05 | 1990-04-10 | Prosoya Corporation | Food processing in oxygen-free environment |
CH676470A5 (en) | 1988-02-03 | 1991-01-31 | Nestle Sa | |
FR2628317B1 (en) | 1988-03-09 | 1991-11-08 | Lvmh Rech | COMPOSITION BASED ON HYDRATED LIPID LAMID PHASES OR LIPOSOMES CONTAINING SCUTELLARIA EXTRACT, OR AT LEAST ONE FLAVONOID SUCH AS BAICALINE OR BAICALINE AND COSMETIC OR PHARMACEUTICAL COMPOSITION, IN PARTICULAR DERMATOLOGICAL, ANTI-ALLERGIC ANTI-ALLERGIC ACTIVITY THE INCORPORANT |
IT1219587B (en) | 1988-05-13 | 1990-05-18 | Fidia Farmaceutici | SELF-CROSS-LINKED CARBOXYLY POLYSACCHARIDES |
US4851214A (en) | 1988-09-07 | 1989-07-25 | Ici Americas Inc. | Deodorants containing N-soya-N-ethyl morpholinium ethosulfate |
US4960588A (en) | 1988-11-16 | 1990-10-02 | Helene Curtis, Inc. | Hair treatment compositions to impart durable hair set retention properties |
US4943462A (en) | 1989-01-17 | 1990-07-24 | Semex Medical, Inc. | Nail treatment device |
LU87449A1 (en) | 1989-02-09 | 1990-09-19 | Oreal | PROCESS FOR THE MANUFACTURE OF FOAMS FOR USE IN THE COSMETIC AND PHARMACEUTICAL AREAS AND FOAMS OBTAINED BY THIS PROCESS |
US5116605A (en) | 1989-03-09 | 1992-05-26 | Alt John P | Composition and skin treatment method therewith for mitigating acne and male-pattern baldness |
AU631425B2 (en) | 1989-04-14 | 1992-11-26 | Wesley-Jessen Corporation | Color binding mechanism for contact lenses |
MY105521A (en) | 1989-04-17 | 1994-10-31 | Healthpoint Ltd | Moisturizing vehicle for topical application of vitamin a acid. |
US5077038A (en) | 1989-07-27 | 1991-12-31 | Vi-Jon Laboratories, Inc. | Nail polish remover |
EP0443005A4 (en) | 1989-09-14 | 1992-02-19 | Sing-Hsiung Chang | Soft gas permeable contact lens having improved clinical performance |
JP2832848B2 (en) | 1989-10-21 | 1998-12-09 | 株式会社林原生物化学研究所 | Crystal 2-O-α-D-glucopyranosyl-L-ascorbic acid, its production method and use |
EP0421021A1 (en) | 1989-10-06 | 1991-04-10 | MUCOS EMULSIONSGESELLSCHAFT m.b.H. | Use of catabolic enzymes to activate macrophages and/or NK cells, medicinal composition containing these enzymes for the activation of macrophages and/or NK cells |
US5554647A (en) | 1989-10-12 | 1996-09-10 | Perricone; Nicholas V. | Method and compositions for treatment and/or prevention of skin damage and aging |
US5032400A (en) | 1989-11-02 | 1991-07-16 | Erie Laboratories | Shark liver oil and garlic oil topical analgesic |
US5834312A (en) | 1990-01-29 | 1998-11-10 | Hy-Gene, Inc. | Process and media for the growth of human epithelia |
US5622690A (en) | 1990-04-05 | 1997-04-22 | Nurture, Inc. | Seed-derived proteinaceous compositions for reduction of sunburn cell formation |
US5077040A (en) | 1990-04-30 | 1991-12-31 | Helene Curtis, Inc. | Hair-treating microemulsion composition and method of preparing and using the same |
US5332758A (en) | 1990-07-13 | 1994-07-26 | Kanebo, Ltd. | Collagen metabolism ameliorant and its use |
CA2047160C (en) | 1990-07-25 | 2002-06-25 | Masahiro Ito | Reactive hot-melt elastic sealant composition |
US5231090A (en) | 1990-07-30 | 1993-07-27 | University Of Miami | Treatment for hypercholesterolemia |
JPH04169520A (en) * | 1990-11-01 | 1992-06-17 | Shiseido Co Ltd | Skin detergent composition |
FR2666474B1 (en) | 1990-08-28 | 1992-11-06 | De Stoutz Jean | DEVICE FOR HEATING FLUIDS BY JOUL EFFECT. |
US5217717A (en) | 1990-09-06 | 1993-06-08 | Central Soya Company, Inc. | Method of making soybean Bowman-Birk inhibitor concentrate and use of same as a human cancer preventative and therapy |
US5130142A (en) | 1990-10-31 | 1992-07-14 | The Practer & Gamble Company | Hair growth regulating composition comprising epithelium cell supernatant-derived growth factor |
JP3032566B2 (en) * | 1990-11-01 | 2000-04-17 | 株式会社資生堂 | External preparation for skin |
DE69107056D1 (en) | 1990-11-14 | 1995-03-09 | Oreal | AMPHIPHILES, NON-IONIC DERIVATIVES OF GLYCERINE AND THE CORRESPONDING INTERMEDIATE PRODUCTS, METHOD FOR THE PRODUCTION THEREOF AND THE COMPOSITIONS CONTAINING THE SAME. |
CA2095046C (en) | 1990-11-27 | 2003-01-28 | Paul L. Valint, Jr. | Surface-active macromonomers |
US5135297A (en) | 1990-11-27 | 1992-08-04 | Bausch & Lomb Incorporated | Surface coating of polymer objects |
US5449794A (en) | 1991-02-15 | 1995-09-12 | Jasmine Fockerman | Benzopyran phenol derivatives for use as antibacterial agents |
GB9104286D0 (en) | 1991-02-28 | 1991-04-17 | Phytopharm Ltd | Pharmaceutical compositions for the treatment of skin disorders |
US5807543A (en) | 1993-08-27 | 1998-09-15 | The Procter & Gamble Co. | Cosmetic compositions containing hydrophobically modified nonionic polymer and unsaturated quaternary ammonium surfactant |
JPH05114905A (en) | 1991-04-08 | 1993-05-07 | Digital Equip Corp <Dec> | Message processing filtering using single address and protocol table bridge |
US5229104A (en) | 1991-04-29 | 1993-07-20 | Richardson-Vicks Inc. | Artificial tanning compositions containing positively charged paucilamellar vesicles |
EP0514576A1 (en) | 1991-05-24 | 1992-11-25 | Societe Des Produits Nestle S.A. | Oil-soluble antioxidant mixture |
US5310734A (en) | 1991-07-05 | 1994-05-10 | Rhone-Poulenc Rorer | Phospholipid composition |
JP3320430B2 (en) | 1991-07-10 | 2002-09-03 | 日本原子力研究所 | Method for producing sterile phospholipid, aqueous phospholipid dispersion or aqueous liposome dispersion by radiation sterilization |
FR2679446B1 (en) | 1991-07-24 | 1993-10-29 | Oreal | METHOD FOR MANUFACTURING A COSMETIC COMPOSITION FOR APPLICATION TO HAIR, COMPOSITION OBTAINED BY THIS PROCESS AND METHOD FOR COSMETIC TREATMENT USING THE SAME. |
US5254331A (en) | 1991-09-12 | 1993-10-19 | Chanel, Inc. | Skin cream composition |
EP0532465B1 (en) * | 1991-09-13 | 2002-07-10 | Pentapharm A.G. | Protein fraction for cosmetic and dermatological care of the skin |
US5260065A (en) | 1991-09-17 | 1993-11-09 | Micro Vesicular Systems, Inc. | Blended lipid vesicles |
US5780459A (en) | 1991-11-25 | 1998-07-14 | The Procter & Gamble Company | Compositions for regulating skin wrinkles and or skin atrophy |
FR2685202B1 (en) | 1991-12-24 | 1995-03-24 | Sederma Sa | NOVEL PHARMACEUTICAL AND COSMETIC TREATMENT METHOD FOR THE REGULATION OF SEBORRHEA, ACNE AND SKIN FLORA. |
FR2687314A1 (en) | 1992-02-18 | 1993-08-20 | Oreal | LIPID VESICLE DISPERSION, COSMETIC AND / OR PHARMACEUTICAL COMPOSITION CONTAINING THE SAME, AND PROCESS FOR THE PREPARATION OF SAID DISPERSION. |
US5766628A (en) | 1992-02-24 | 1998-06-16 | Merz + Co. Gmbh & Co. | Bath and shower composition having vesicle-forming properties and method for the production and use thereof |
DE4206090C2 (en) | 1992-02-27 | 1998-02-05 | Perycut Chemie Ag | Insect repellent |
US5322689A (en) | 1992-03-10 | 1994-06-21 | The Procter & Gamble Company | Topical aromatic releasing compositions |
US5248495A (en) | 1992-04-16 | 1993-09-28 | The Procter & Gamble Company | Post foaming shaving gel composition |
EP0574352A1 (en) | 1992-06-09 | 1993-12-15 | Ciba-Geigy Ag | Process for graft polymerization on surfaces of preformed substrates to modify surface properties |
US5352443A (en) | 1992-06-15 | 1994-10-04 | Shiseido Co., Ltd. | Permanent waving composition |
FR2692783B1 (en) | 1992-06-25 | 1995-05-05 | Expanchimie | Compositions based on unsaponifiable fractions of wheat germ and sesame oils, and their uses in particular in cosmetology and as a food supplement. |
US5643601A (en) | 1992-06-26 | 1997-07-01 | Lancaster Group Ag | Phospholipid-and fluorocarbon-containing cosmetic |
US5641509A (en) | 1992-06-26 | 1997-06-24 | Lancaster Group Ag | Preparation for topical use |
DE4221256C2 (en) | 1992-06-26 | 1997-07-10 | Lancaster Group Ag | Galenic composition for topical use |
US5438044A (en) | 1992-06-30 | 1995-08-01 | Rhone-Poulenc Rorer | Phospholipid composition |
ES2136105T3 (en) | 1992-08-04 | 1999-11-16 | Rhone Poulenc Rorer Gmbh | PHARMACEUTICAL AND / OR COSMETIC PREPARATION. |
FR2694934B1 (en) | 1992-08-24 | 1994-11-10 | Oreal | Composition for the treatment of acne containing a salicylic acid derivative and salicylic acid derivatives. |
JPH06192085A (en) | 1992-08-31 | 1994-07-12 | Yuji Inada | Therapeutic agent for mite allergy |
IL106922A (en) | 1992-09-14 | 1998-08-16 | Novartis Ag | Composite materials with one or more wettable surfaces and process for their preparation |
US5753612A (en) | 1992-10-27 | 1998-05-19 | Yissum Research Development Co. Of The Hebrew University Of Jerusalem | Pharmaceutical composition and method for inhibiting hair growth by administration of activin or activin agonists |
JP3257091B2 (en) | 1992-11-06 | 2002-02-18 | 不二製油株式会社 | Anti-skin cancer agent or food |
US5565439A (en) | 1992-11-24 | 1996-10-15 | The Procter & Gamble Company | Methods of using lysophosphatidic acid for treating hyperproliferative conditions |
JP2580942B2 (en) | 1992-12-24 | 1997-02-12 | ティアック株式会社 | Magnetic tape device and method of moving the magnetic head |
US5270042A (en) | 1993-02-23 | 1993-12-14 | Juanita Whitham | Medicinal salve composition |
RU2066992C1 (en) | 1993-03-01 | 1996-09-27 | Надежда Михайловна Остроумова | Method and remedy for removing hairs |
JP3091045B2 (en) * | 1993-03-04 | 2000-09-25 | 丸善製薬株式会社 | Skin cosmetics |
CA2119064A1 (en) | 1993-03-17 | 1994-09-18 | Richard A. Berg | Dermal-epidermal in vitro test system |
CN1081899A (en) | 1993-04-24 | 1994-02-16 | 王丽华 | Broad-spectrum ointment |
TW253849B (en) | 1993-08-09 | 1995-08-11 | Ciba Geigy | |
FR2709756B1 (en) | 1993-09-10 | 1995-10-20 | Essilor Int | Hydrophilic, transparent material with high oxygen permeability, based on a polymer with interpenetrating networks, its method of preparation and manufacture of soft contact lenses with high oxygen permeability. |
FR2710524B1 (en) | 1993-09-28 | 1995-11-17 | Oreal | Composition of nail polish containing an epoxidized oil as a plasticizer. |
US5641863A (en) | 1993-09-30 | 1997-06-24 | University Of Pennsylvania | Chimeric IgG Fc receptors |
IL111105A (en) | 1993-09-30 | 2009-05-04 | Univ Pennsylvania | Use of a molecule capable of inhibiting the expression of syk kinase to prepare a pharmaceutical composition for inhibiting phagocytosis |
US5681571A (en) | 1993-10-08 | 1997-10-28 | Duotol Ab | Immunological tolerance-inducing agent |
JPH07121869B2 (en) | 1993-10-12 | 1995-12-25 | 浩 前田 | Inhibitors of inflammatory edema promotion |
GB9322007D0 (en) | 1993-10-26 | 1993-12-15 | Unilever Plc | Cosmetic composition |
US5681852A (en) | 1993-11-12 | 1997-10-28 | The Procter & Gamble Company | Desquamation compositions |
EP0655470B1 (en) | 1993-11-26 | 1999-05-12 | Novartis AG | Cross-linkable copolymers and hydrogels |
DE4343431C1 (en) | 1993-12-18 | 1995-05-04 | Henkel Kgaa | Cosmetic and/or pharmaceutical compositions |
JPH07196529A (en) | 1993-12-29 | 1995-08-01 | Morinaga Milk Ind Co Ltd | Wound-curing agent, cosmetic and hair tonic |
JPH07196527A (en) | 1993-12-29 | 1995-08-01 | Morinaga Milk Ind Co Ltd | Peptide or its derivative and cell growth activator |
FR2714602B1 (en) | 1993-12-30 | 1996-02-09 | Oreal | Anti-acne composition for the simultaneous treatment of the superficial and deep layers of the skin, its use. |
FR2714604B1 (en) | 1993-12-30 | 1996-01-26 | Oreal | Use of a spin acceptor in a cosmetic or dermatological composition. |
FR2714599B1 (en) | 1993-12-30 | 1996-02-09 | Oreal | Composition for fighting against aging, acting simultaneously on the superficial and deep layers of the skin, its use. |
FR2714597B1 (en) | 1993-12-30 | 1996-02-09 | Oreal | Moisturizing composition for the simultaneous treatment of the superficial and deep layers of the skin, its use. |
FR2714598B1 (en) | 1993-12-30 | 1996-02-09 | Oreal | Slimming composition with two types of liposomes for topical treatment, its use. |
JPH0899891A (en) * | 1994-01-21 | 1996-04-16 | Pola Chem Ind Inc | Skin external agent |
US5468473A (en) | 1994-02-09 | 1995-11-21 | Innova Products, Inc. | Antiperspirant for hands and feet |
IL112649A (en) | 1994-02-22 | 1999-12-22 | Curtis Helene Ind Inc | Topically effective compositions for application to the skin or hair |
US5547661A (en) | 1994-02-22 | 1996-08-20 | Helene Curtis, Inc. | Antiperspirant deodorant compositions |
FR2717075B1 (en) | 1994-03-14 | 1996-04-05 | Oreal | Aqueous organopolysiloxane makeup gel. |
US5455234A (en) | 1994-03-16 | 1995-10-03 | Ahluwalia; Gurpreet S. | Inhibition of hair growth |
FR2719219B1 (en) | 1994-05-02 | 1996-06-21 | Rocher Yves Biolog Vegetale | Cosmetic or pharmaceutical composition for topical use comprising lipid vesicles. |
JP3127713B2 (en) | 1994-05-10 | 2001-01-29 | 株式会社村田製作所 | Optimal condition analysis method for powder molding |
JPH07304655A (en) | 1994-05-13 | 1995-11-21 | Kikkoman Corp | Bathing agent and its production |
FR2720937B1 (en) | 1994-06-08 | 1997-03-28 | Oreal | Cosmetic or dermatological composition in the form of an aqueous and stable dispersion of cubic gel particles based on phytantriol and containing a fatty chain surfactant as a dispersing and stabilizing agent. |
FR2720934B1 (en) | 1994-06-14 | 1996-07-12 | Oreal | Oil-in-water cleaning emulsion with the appearance of milk. |
JPH0812560A (en) | 1994-06-29 | 1996-01-16 | Shiseido Co Ltd | Skin external preparation |
DE4424210C2 (en) | 1994-07-09 | 1997-12-04 | Beiersdorf Ag | Use of compositions containing surfactants and containing oil components, which are otherwise water-free, as cosmetic or dermatological shower oils |
US5444092A (en) | 1994-07-20 | 1995-08-22 | Collins; Jerry | Method and composition for treating psoriasis |
JPH0859450A (en) | 1994-08-18 | 1996-03-05 | Kose Corp | External preparation for skin |
DE4432947C2 (en) | 1994-09-16 | 1998-04-09 | New Standard Gmbh | Agent for the treatment of the skin and its use |
DE4433071C1 (en) | 1994-09-16 | 1995-12-21 | Henkel Kgaa | Mild detergent mixtures |
US5554608A (en) | 1994-09-28 | 1996-09-10 | Ahluwalia; Gurpreet S. | Inhibition of hair growth |
JPH08143442A (en) | 1994-11-16 | 1996-06-04 | Kikkoman Corp | Skin external preparation and its production |
US5567420A (en) | 1994-11-16 | 1996-10-22 | Mceleney; John | Lotion which is temporarily colored upon application |
JP3647093B2 (en) | 1994-11-17 | 2005-05-11 | 株式会社メニコン | Hydrophilized oxygen permeable contact lens and method for producing the same |
CN1169112A (en) | 1994-12-06 | 1997-12-31 | 普罗克特和甘保尔公司 | Shelf stable skin cleansing liquid with gel forming polymer lipid and crystalling ethylene glycol fatty acid ester |
PL182804B1 (en) | 1995-02-07 | 2002-03-29 | Fidia Advanced Biopolymers | Method of coating objects with hialuronic acid, its derivatives and semi-synthetic polymers |
FR2730928B1 (en) | 1995-02-23 | 1997-04-04 | Oreal | COMPOSITION BASED ON LIPIDIC VESICLES WITH ACIDIC PH AND USE THEREOF IN TOPICAL APPLICATION |
AU697323B2 (en) | 1995-03-23 | 1998-10-01 | Lancaster Group Gmbh | Cosmetic with condensates of plant and animal decomposition products |
FR2733148B1 (en) | 1995-04-20 | 1997-05-30 | Oreal | COMPOSITION FOR FIGHTING AGAINST SPOTS AND / OR AGING OF THE SKIN, USES THEREOF |
GB9510833D0 (en) | 1995-05-27 | 1995-07-19 | Procter & Gamble | Cleansing compositions |
US5942479A (en) | 1995-05-27 | 1999-08-24 | The Proctor & Gamble Company | Aqueous personal cleansing composition with a dispersed oil phase comprising two specifically defined oil components |
US5985809A (en) | 1995-05-27 | 1999-11-16 | The Procter & Gamble Company | Aqueous personal cleansing compositions comprising specific nonocclusive liquid polyol fatty acid polyester |
JP3911642B2 (en) | 1995-06-06 | 2007-05-09 | 株式会社加美乃素本舗 | Topical skin preparation |
AU723595B2 (en) | 1995-06-07 | 2000-08-31 | University Of Pennsylvania | Methods of inhibiting phagocytosis |
US5523308A (en) * | 1995-06-07 | 1996-06-04 | Costanzo; Michael J. | Peptidyl heterocycles useful in the treatment of thrombin related disorders |
US5639785A (en) | 1995-06-07 | 1997-06-17 | Global Pharma, Ltd. | Methods for the treatment of baldness and gray hair using isoflavonoid derivatives |
CA2223747A1 (en) | 1995-06-07 | 1996-12-19 | Taisho Pharmaceutical Co., Ltd. | Antifungal compositions |
JPH0840824A (en) | 1995-06-21 | 1996-02-13 | Nonogawa Shoji Kk | Cosmetic |
ES2110857T3 (en) | 1995-06-21 | 1998-02-16 | Oreal | COSMETIC COMPOSITION THAT INCLUDES A DISPERSION OF PARTICLES OF POLYMER. |
US6126933A (en) | 1995-06-27 | 2000-10-03 | Genetics Institute | Methods of treating inflammatory bowel diseases by administering IL-11 |
CN1146876A (en) | 1995-06-28 | 1997-04-09 | 李缯宏 | Beauty bean milk |
JP3410870B2 (en) | 1995-07-13 | 2003-05-26 | 株式会社資生堂 | External preparation for skin |
JPH0925213A (en) | 1995-07-13 | 1997-01-28 | Shiseido Co Ltd | Skin preparation for external use |
JPH0925212A (en) | 1995-07-13 | 1997-01-28 | Shiseido Co Ltd | Skin preparation for external use |
US5571503A (en) | 1995-08-01 | 1996-11-05 | Mausner; Jack | Anti-pollution cosmetic composition |
US5874127A (en) | 1995-08-16 | 1999-02-23 | Ciba Vision Corporation | Method and apparatus for gaseous treatment |
JPH0977638A (en) | 1995-09-19 | 1997-03-25 | Art Beauty Clinic Kk | Foundation for cosmetic |
US6063398A (en) | 1995-09-20 | 2000-05-16 | L'oreal | Cosmetic or dermopharmaceutical patch containing, in an anhydrous polymeric matrix, at least one active compound which is, in particular, unstable in oxidizing mediums, and at least one water-absorbing agent |
US5683683A (en) | 1995-09-21 | 1997-11-04 | Helene Curtis, Inc. | Body wash composition to impart conditioning properties to skin |
US5635165A (en) | 1995-09-27 | 1997-06-03 | Helene Curtis, Inc. | Antiperspirant deodorant compositions |
EP0798305B1 (en) | 1995-10-17 | 2007-10-03 | Showa Denko Kabushiki Kaisha | High-purity tocopherol phosphates, process for the preparation thereof, method for analysis thereof, and cosmetics |
NZ299379A (en) | 1995-10-27 | 1997-04-24 | Unilever Plc | Topical flavanone-containing composition |
US6238678B1 (en) | 1995-11-06 | 2001-05-29 | The Procter & Gamble Company | Methods of regulating skin appearance with vitamin B3 compound |
US6509098B1 (en) | 1995-11-17 | 2003-01-21 | Massachusetts Institute Of Technology | Poly(ethylene oxide) coated surfaces |
US5961980A (en) | 1996-01-18 | 1999-10-05 | The Trustees Of The University Of Pennsylvania | Bowman-birk inhibitor compositions and methods for the treatment of genitourinary diseases |
US5643587A (en) | 1996-02-15 | 1997-07-01 | Avon Products, Inc. | Composition and method for under-eye skin lightening |
WO1997035998A1 (en) * | 1996-03-28 | 1997-10-02 | Trustees Of Boston University | Methods of modulating melanin synthesis |
AU1793397A (en) | 1996-03-29 | 1997-10-22 | S.W. Patentverwertungs Ges. M.B.H. Edelsbacher U. Partner | Cosmetic or cosmetic preparation for smoothing and tightening the skin in the case of subcutaneous fatty tissue problems, particularly cellulite |
FR2747568B1 (en) | 1996-04-17 | 1999-09-17 | Oreal | USE OF AT LEAST ONE LIPOXYGENASE INHIBITOR AND AT LEAST ONE CYCLO-OXYGENASE INHIBITOR FOR MODIFYING HAIR AND / OR HAIR GROWTH |
WO1997039734A1 (en) | 1996-04-23 | 1997-10-30 | The Procter & Gamble Company | Methods of regulating skin condition with centella asiatica extract |
US5834513A (en) | 1996-04-25 | 1998-11-10 | Avon Products, Inc. | Oxa diacids and related compounds for treating skin conditions |
CN1166960A (en) | 1996-06-04 | 1997-12-10 | 金建文 | Composite beauty masque powder containing spirulina |
US5824702A (en) | 1996-06-07 | 1998-10-20 | Mount Sinai School Of Medicine Of The City University Of New York | Genistein as a preventive against ultraviolet induced skin photodamage and cancer |
US5821361A (en) | 1996-06-11 | 1998-10-13 | Protein Technologies International, Inc. | Recovery of isoflavones from soy molasses |
BR9602991A (en) | 1996-07-05 | 1998-04-28 | Cosmeticos Natural Ind Com | Skin moisturizing and protective cosmetic compositions against ultraviolet and infrared radiation |
DK0996409T3 (en) * | 1996-07-12 | 2003-08-11 | Johnson & Johnson Consumer | Preparation to delay hair growth and similar use |
BR9603084A (en) | 1996-07-12 | 1998-05-05 | Cosmeticos Natural Ind Com | Dry emulsion composition for skin |
JPH10120560A (en) | 1996-08-26 | 1998-05-12 | Sankyo Co Ltd | Loxoprofen-containing preparation for external use |
DE19634206C2 (en) | 1996-08-26 | 2000-01-20 | Ludwig Reinke | Skin care products, in particular for aging skin |
US5804234A (en) | 1996-09-13 | 1998-09-08 | Suh; John D. | Plant protein for nutritional products and method of making same |
DE19638534A1 (en) | 1996-09-20 | 1998-03-26 | Beiersdorf Ag | Use of tocopheryl ferulate as skin bleaching agent |
FR2753626B1 (en) | 1996-09-20 | 1998-11-06 | Centre International De Rech Dermatologiques Galderma Cird Galderma | NOVEL TOPICAL COMPOSITIONS IN THE FORM OF A FLUID O / W EMULSION WITH A HIGH PRO-PENETRATING GLYCOL CONTENT |
US5665367A (en) | 1996-09-27 | 1997-09-09 | Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. | Skin care compositions containing naringenin and/or quercetin and a retinoid |
FR2754713B1 (en) | 1996-10-22 | 1999-01-08 | Roc Sa | USE OF COMPLEXES FOR THE PREPARATION OF COMPOSITIONS FOR THE TREATMENT OF SENSITIVE SKIN, PREPARATION METHOD AND HYPOALLERGENIC COMPOSITIONS |
US6593290B1 (en) | 1996-11-01 | 2003-07-15 | Genentech, Inc. | Treatment of inner ear hair cells |
JPH10139654A (en) * | 1996-11-08 | 1998-05-26 | Lion Corp | Composition for external skin use |
IT1288257B1 (en) | 1996-11-29 | 1998-09-11 | Paoli Ambrosi Gianfranco De | COMPOSITION FOR COSMETIC, PHARMACEUTICAL OR DIETETIC USE BASED ON AN AMINO SUGAR AND / OR A POLYHYDROXYL ACID |
FR2757767B1 (en) | 1996-12-27 | 1999-02-05 | Oreal | TOPICAL COMPOSITION CONTAINING AT LEAST ONE PLANT-BASED PROTEIN AND / OR ANIMAL-BASED PROTEIN AND A POLY (2-ACRYLAMIDO 2-METHYLPROPANE SULFONIC ACID) CROSSLINKED |
DE19818849A1 (en) | 1997-04-28 | 1998-10-29 | Med Beauty Ag | Formulation to promote deep skin penetration |
US5962015A (en) | 1997-05-02 | 1999-10-05 | Kobo Products S.A.R.L. | Stabilized liposomes |
US6060070A (en) | 1997-06-11 | 2000-05-09 | Gorbach; Sherwood L. | Isoflavonoids for treatment and prevention of aging skin and wrinkles |
FR2765106B1 (en) | 1997-06-27 | 2000-12-15 | Dior Christian Parfums | USE OF CROSSLINKED TANNINS IN THE PRESENCE OF NON-CROSSLINKED PROTEINS WITH TANNINS AS COSMETIC AGENTS TO IMPROVE SKIN SMOOTHING AND / OR TO OBTAIN AN ASTRINGENT EFFECT |
US8039026B1 (en) | 1997-07-28 | 2011-10-18 | Johnson & Johnson Consumer Companies, Inc | Methods for treating skin pigmentation |
DE19735587B4 (en) | 1997-08-16 | 2012-03-22 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | A peptide having a radioprotective effect, a cosmetic or pharmaceutical composition containing the same, a nucleic acid encoding the same, a preparation process for this peptide and the use as a radioprotective agent |
AR015455A1 (en) | 1997-09-23 | 2001-05-02 | Novartis Ag | METHOD FOR THE SURFACE TREATMENT OF A POLYMERIC ARTICLE, AND SUCH ARTICLE OBTAINED |
US5972355A (en) | 1997-09-30 | 1999-10-26 | E-L Management Corp. | Stable compositions containing biologically active components |
US5928658A (en) | 1997-12-05 | 1999-07-27 | U.S. Cosmetics | Oil-free wax-free solid cosmetic composition |
CA2314899A1 (en) | 1997-12-16 | 1999-06-24 | Johnson & Johnson Consumer Companies, Inc. | Compositions and methods for regulating phagocytosis and icam-1 expression |
DE19804376B4 (en) | 1998-02-04 | 2004-09-16 | Johnson & Johnson Gmbh | Lipid mixtures and their use |
US5928889A (en) | 1998-02-13 | 1999-07-27 | S.C. Johnson & Son, Inc. | Protocol for simulated natural biofilm formation |
US5965153A (en) | 1998-03-24 | 1999-10-12 | Stabar Enterprises, Inc. | Dietary supplement for preventing or reducing shedding by animals |
US6323219B1 (en) * | 1998-04-02 | 2001-11-27 | Ortho-Mcneil Pharmaceutical, Inc. | Methods for treating immunomediated inflammatory disorders |
ID27989A (en) | 1998-05-05 | 2001-05-03 | Bausch & Lomb | PLASMA SURFACE TREATMENT IN HYDRAULIC SILICONE CONTACT LENS |
US6087415A (en) | 1998-06-11 | 2000-07-11 | Johnson & Johnson Vision Care, Inc. | Biomedical devices with hydrophilic coatings |
US6750229B2 (en) * | 1998-07-06 | 2004-06-15 | Johnson & Johnson Consumer Companies, Inc. | Methods for treating skin pigmentation |
EP1120108B1 (en) | 1998-10-09 | 2006-08-02 | Kabushiki Kaisha Yakult Honsha | Skin care preparations for external use |
US20020006418A1 (en) | 1998-10-13 | 2002-01-17 | John Kung | Composition to enhance permeation of topical skin agents |
US6096327A (en) | 1998-11-05 | 2000-08-01 | Protease Sciences Inc. | Cosmetic compositions containing human type serine protease inhibitors for revitalizing the skin |
US6521237B2 (en) | 1998-11-12 | 2003-02-18 | Johnson & Johnson Consumer Companies, Inc. | Skin care composition |
US20020197244A1 (en) | 1998-12-07 | 2002-12-26 | Miri Seiberg | Compositions and methods for regulating phagocytosis and ICAM-1 expression |
DE69915697T2 (en) | 1999-01-19 | 2005-01-13 | Pharmacia & Upjohn Co., Kalamazoo | Packing procedure for oxidation-sensitive drugs |
AU3390400A (en) | 1999-03-05 | 2000-09-21 | Johns Hopkins University, The | Regulating skin appearance and composition with a fluorinated vitamin d3 analog compound |
WO2000062741A2 (en) | 1999-04-19 | 2000-10-26 | The Procter & Gamble Company | Skin care compositions containing combination of skin care actives |
US6492326B1 (en) | 1999-04-19 | 2002-12-10 | The Procter & Gamble Company | Skin care compositions containing combination of skin care actives |
AU4647200A (en) | 1999-04-19 | 2000-11-02 | Procter & Gamble Company, The | Skin care compositions containing combination of skin care actives |
AU4647300A (en) | 1999-04-19 | 2000-11-02 | Procter & Gamble Company, The | Skin care compositions containing combination of skin care actives |
US6444647B1 (en) | 1999-04-19 | 2002-09-03 | The Procter & Gamble Company | Skin care compositions containing combination of skin care actives |
US6261603B1 (en) | 1999-05-11 | 2001-07-17 | Mcelwain Elizena A. | Skin cream |
US6447809B1 (en) | 1999-05-11 | 2002-09-10 | Metagenics, Inc. | Composition for promoting healthy bone structure |
CN1177580C (en) | 1999-05-17 | 2004-12-01 | 宝洁公司 | Methods for regulating the condition of mammalian keratinous tissue via topical application of phytosterol compositions |
JP2002544218A (en) | 1999-05-18 | 2002-12-24 | ザ、プロクター、エンド、ギャンブル、カンパニー | Methods for adjusting keratin tissue status in mammals |
AU5026600A (en) | 1999-05-18 | 2000-12-05 | Procter & Gamble Company, The | Methods of regulating the condition of mammalian keratinous tissue |
AU5026700A (en) | 1999-05-18 | 2000-12-05 | Procter & Gamble Company, The | Methods for upregulating and/or modulating kgf production and increasing receptivity of keratinocytes to kgf |
JP3661981B2 (en) | 1999-06-09 | 2005-06-22 | 株式会社ノエビア | Antiperspirant |
US6391288B1 (en) | 1999-07-27 | 2002-05-21 | Shiseido Co., Ltd. | Microcapsule and method of making the same |
BR0007404A (en) | 1999-11-05 | 2002-04-09 | Johnson & Johnson Consumer | Soy compositions for depigmentation and skin care |
JP2003514001A (en) | 1999-11-16 | 2003-04-15 | ユニリーバー・ナームローゼ・ベンノートシヤープ | Beauty composition comprising chickpea extract and retinoid |
FR2803747B1 (en) | 2000-01-18 | 2003-12-26 | Pharmascience Lab | USE OF ISOFLAVONES AND / OR EXTRACTS OF AFRICAN PLUM IN PHARMACY, COSMETICS AND AS A FOOD ADDITIVE. |
FR2807320B1 (en) | 2000-04-10 | 2002-05-24 | Oreal | USE OF ASCORBIC ACID DERIVATIVES FOR INCREASING THE SYNTHESIS OF EPIDERMAL CRERAMIDES |
US6433025B1 (en) | 2000-04-13 | 2002-08-13 | Cyanotech Corporation | Method for retarding and preventing sunburn by UV light |
US6558656B2 (en) | 2000-04-20 | 2003-05-06 | Morris Mann | Oral and topical compositions and methods related thereto in the treatment of acne |
FR2811226B1 (en) | 2000-06-05 | 2003-06-20 | Clarins Laboratoires S A S | MOISTURIZING COSMETIC COMPOSITION COMPRISING A PLANT TRYPSIN INHIBITOR |
US6432424B1 (en) | 2000-06-29 | 2002-08-13 | Johnson & Johnson Consumer Companies, Inc. | Cosmetic compositions containing creatine, carnitine, and/or pyruvic acid |
KR20020025804A (en) | 2000-09-29 | 2002-04-04 | 미쉘 지. 멘지니 | Composition to enhance permeation of topical skin agents |
US6482446B2 (en) | 2000-12-01 | 2002-11-19 | Neutrogena Corporation | Astringent composition and method of use |
EP1352637B1 (en) | 2000-12-22 | 2009-07-01 | Shiseido Company, Ltd. | Hair growth inhibitors and compositions containing the same |
JP4169514B2 (en) | 2001-01-31 | 2008-10-22 | 松下電器産業株式会社 | Method and apparatus for manufacturing spiral electrode group |
BR0207663A (en) | 2001-02-27 | 2005-10-25 | Univ Michigan | Use of natural egfr inhibitors to prevent side effects due to therapy with retinoids, soaps and other stimuli that activate the epidermal growth factor receptor. |
DE60235132D1 (en) | 2001-02-28 | 2010-03-11 | Johnson & Johnson Consumer | Sojaprodukte containing compositions |
US20020160061A1 (en) | 2001-02-28 | 2002-10-31 | Claude Saliou | Use of legume products for the treatment of external aggressions |
US7192615B2 (en) | 2001-02-28 | 2007-03-20 | J&J Consumer Companies, Inc. | Compositions containing legume products |
AU2002305054B2 (en) | 2001-03-16 | 2006-09-07 | Johnson & Johnson Consumer Inc. | Composition containing feverfew extract and use thereof |
US20030224075A1 (en) | 2002-02-21 | 2003-12-04 | Jue-Chen Liu | Soy composition for balancing combination skin |
JP2004000019A (en) | 2002-03-27 | 2004-01-08 | Ikeda Shokken Kk | Denaturation inhibitor and liquid composition |
US20050022314A1 (en) | 2003-07-30 | 2005-02-03 | Hal Ambuter | Processes |
EP1543823A1 (en) | 2003-12-19 | 2005-06-22 | Johnson & Johnson Consumer France SAS | Gingko containing formulations for the improvement of skin radiance |
-
1998
- 1998-07-06 US US09/110,409 patent/US8039026B1/en not_active Expired - Fee Related
- 1998-07-23 JP JP50978599A patent/JP4401441B2/en not_active Expired - Fee Related
- 1998-07-23 DK DK98939062T patent/DK0948308T3/en active
- 1998-07-23 EP EP98939062A patent/EP0948308B1/en not_active Expired - Lifetime
- 1998-07-23 BR BR9806118-6A patent/BR9806118A/en not_active Application Discontinuation
- 1998-07-23 ES ES98939062T patent/ES2215317T3/en not_active Expired - Lifetime
- 1998-07-23 IL IL12909098A patent/IL129090A0/en unknown
- 1998-07-23 HU HU0000216A patent/HUP0000216A3/en unknown
- 1998-07-23 KR KR1019997002644A patent/KR100691395B1/en not_active IP Right Cessation
- 1998-07-23 DE DE69821913T patent/DE69821913T2/en not_active Expired - Lifetime
- 1998-07-23 BR BRPI9816322-1B1A patent/BR9816322B1/en not_active IP Right Cessation
- 1998-07-23 PL PL98333284A patent/PL333284A1/en unknown
- 1998-07-23 CN CN98801022.4A patent/CN1234735B/en not_active Expired - Lifetime
- 1998-07-23 CA CA2267077A patent/CA2267077C/en not_active Expired - Lifetime
- 1998-07-23 AT AT98939062T patent/ATE260083T1/en active
- 1998-07-23 ID IDW990134A patent/ID22061A/en unknown
- 1998-07-23 WO PCT/US1998/009799 patent/WO1999004752A2/en active IP Right Grant
- 1998-07-23 AU AU87566/98A patent/AU8756698A/en not_active Abandoned
- 1998-07-23 PT PT98939062T patent/PT948308E/en unknown
- 1998-07-27 AR ARP980103691A patent/AR016780A1/en unknown
- 1998-09-04 TW TW087112280A patent/TW557216B/en not_active IP Right Cessation
-
2007
- 2007-10-30 US US11/929,488 patent/US20080249029A1/en not_active Abandoned
-
2008
- 2008-11-04 JP JP2008283213A patent/JP2009114187A/en active Pending
-
2011
- 2011-07-15 US US13/183,913 patent/US20120027706A1/en not_active Abandoned
Patent Citations (99)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2924525A (en) * | 1957-06-03 | 1960-02-09 | Central Soya Co | Poultry treatment for skin pigmentation |
US2876164A (en) * | 1957-08-01 | 1959-03-03 | Dome Chemicals Inc | Dermatological preparation containing defatted soy bean flour |
US4007266A (en) * | 1968-05-03 | 1977-02-08 | Choay S.A. | Pharmaceutical composition containing vitamin B12, process of making the same and method of treatment |
US4386067A (en) * | 1969-04-30 | 1983-05-31 | Expanscience | Cosmetic compositions |
US4331692A (en) * | 1971-07-23 | 1982-05-25 | Ulla Drevici | Cocoa fruits and products |
US4254105A (en) * | 1975-10-11 | 1981-03-03 | The Lion Dentifrice Co., Ltd. | Multiple emulsion having a form of water/oil/water phase and process for preparation thereof, and multiple emulsion type cosmetics |
US4151304A (en) * | 1976-11-05 | 1979-04-24 | Lever Brothers Company | Method and composition for moisturizing the skin |
US4370315A (en) * | 1977-02-22 | 1983-01-25 | Sederma | Post-depilatory composition reducing progressively the growth of body hair |
US4190671A (en) * | 1977-03-17 | 1980-02-26 | Biorex Laboratories Limited | Chalcone derivatives |
US4434095A (en) * | 1979-02-04 | 1984-02-28 | Institute Organicheskogo Sinteza | Cyclic analogue of naturally-occurring phagocytosis-stimulant peptide - threonyl-cyclo-[-N.sup.ε -lysyl-prolyl-arginyl] |
US4427670A (en) * | 1980-03-27 | 1984-01-24 | Mitsubishi Chemical Industries Limited | Skin preparation |
US4515778A (en) * | 1981-03-12 | 1985-05-07 | Wolfgang Kastell | Preparation for conditioning and grooming the hair |
US4437895A (en) * | 1981-07-23 | 1984-03-20 | Societe Anonyme Dite: L'oreal | Mixture of vegetable oils based on jojoba oil and cosmetic compositions comprising the mixture |
US4439418A (en) * | 1981-07-29 | 1984-03-27 | Henkel Kgaa | Topical preparations for the treatment of seborrhea and process for inhibiting sebum production |
US4368187A (en) * | 1981-08-03 | 1983-01-11 | Eli Lilly And Company | Sensitive-skin care regime |
US4382960A (en) * | 1981-08-03 | 1983-05-10 | Eli Lilly And Company | Cosmetic cleanser formulation |
US4578267A (en) * | 1981-09-15 | 1986-03-25 | Morton Thiokol, Inc. | Skin conditioning polymer containing alkoxylated nitrogen salts of sulfonic acid |
US4512973A (en) * | 1983-10-12 | 1985-04-23 | Genentech, Inc. | Method for overcoming trypsin inhibition |
US5192332A (en) * | 1983-10-14 | 1993-03-09 | L'oreal | Cosmetic temporary coloring compositions containing protein derivatives |
US4584190A (en) * | 1983-11-17 | 1986-04-22 | Kao Corporation | Novel chalcone derivatives and ultraviolet absorbers comprising the same |
US4727088A (en) * | 1984-02-06 | 1988-02-23 | Neutrogena Corporation | Retinoid composition having enhanced bioavailability and percutaneous absorption |
US4834076A (en) * | 1985-04-17 | 1989-05-30 | Millet Jean M | Device for treating the external human epithelium, process for its manufacture and process for using such a device |
US5006337A (en) * | 1987-04-16 | 1991-04-09 | Marbert Gmbh | Medicinal compositions based on spent brewers' grains extract, a process for the preparation thereof, and the use of spent brewers' grains extract for the preparation of cosmetic compositions, and a special brewers' grains extract |
US4824662A (en) * | 1987-06-15 | 1989-04-25 | Vi-Jon Laboratories, Inc. | Nail polish remover |
US4895839A (en) * | 1987-07-10 | 1990-01-23 | INDENZA S.p.A. | Pharmaceutical and cosmetic compositions containing complexes of flavanolignans with phospholipids |
US5104655A (en) * | 1987-07-27 | 1992-04-14 | Indena S.P.A. | Polyunsaturated acids having vasokinetic action and pharmaceutical and cosmetic formulations containing them |
US5002761A (en) * | 1988-05-02 | 1991-03-26 | Henkel Kommanditgesellschaft Auf Aktien | Hair treatment compositions containing natural ingredients |
US4906457A (en) * | 1988-09-06 | 1990-03-06 | Washington State University Research Foundation, Inc. | Compositions and methods for reducing the risk of sunlight and ultraviolet induced skin cancer |
US5194252A (en) * | 1989-07-27 | 1993-03-16 | Vijon Laboratories, Inc. | Moisture retaining aftershave |
US5179091A (en) * | 1990-06-22 | 1993-01-12 | Adir Et Compagnie | Chalcones |
US5407675A (en) * | 1990-08-10 | 1995-04-18 | Etemad-Moghadam; Parviz | Method and composition for use on the scalp and eyebrow region of a subject |
US5306444A (en) * | 1990-08-24 | 1994-04-26 | Shiseido Company Ltd. | Washing composition capable of preventing and ameliorating skin irritation |
US5110603A (en) * | 1991-01-31 | 1992-05-05 | Kao Corporation | Bathing preparation for colloidal material |
US5188823A (en) * | 1991-02-07 | 1993-02-23 | Stepan Company | Antiperspirant formulations |
US5498420A (en) * | 1991-04-12 | 1996-03-12 | Merz & Co. Gmbh & Co. | Stable small particle liposome preparations, their production and use in topical cosmetic, and pharmaceutical compositions |
US5603949A (en) * | 1991-08-01 | 1997-02-18 | Lvmh Recherche | Use of a tocopherol phosphate or one of its derivatives, for the preparation of cosmetic or pharmaceutical compositions and compositions so obtained |
US5869470A (en) * | 1991-11-25 | 1999-02-09 | The Procter & Gamble Company | Compositions for regulating skin wrinkles and/or skin atrophy |
US5595984A (en) * | 1991-11-25 | 1997-01-21 | Richardson-Vicks Inc. | Use of salicylic acid for regulating skin wrinkles and/or skin atrophy |
US5597814A (en) * | 1991-11-25 | 1997-01-28 | Richardson-Vicks Inc. | Use of salicylic acid for regulating skin wrinkles and/or skin atrophy |
US5605894A (en) * | 1991-11-25 | 1997-02-25 | Richardson-Vicks Inc. | Compositions for regulating skin wrinkles and/or skin atrophy |
US5616572A (en) * | 1991-11-25 | 1997-04-01 | Richardson-Vicks Inc. | Use of salicylic acid for regulating skin wrinkles and/or skin atrophy |
US5393519A (en) * | 1992-03-27 | 1995-02-28 | Helene Curtis, Inc. | Shampoo compositions |
US5397497A (en) * | 1992-08-07 | 1995-03-14 | Solvay Fluor Und Derivate Gmbh | Bath additive composition containing polyglycerol fatty acid ester mixture |
US6048520A (en) * | 1992-09-24 | 2000-04-11 | Helene Curtis, Inc. | Clear leave-on hair treatment composition and method |
US5276058A (en) * | 1993-06-09 | 1994-01-04 | Nippon Hypox Laboratories Incorporated | 3,4-dihydroxychalcone derivatives |
US5614180A (en) * | 1993-08-30 | 1997-03-25 | Helene Curtis, Inc. | Shampoo-conditioner composition |
US5741496A (en) * | 1993-09-21 | 1998-04-21 | Laboratoires De Biologie Vegetale Yves Rocher | Process for the treatment of skins having dry areas and greasy areas |
US5510391A (en) * | 1993-10-22 | 1996-04-23 | Mayapple Holdings, Llc | Method of treating blood vessel disorders of the skin using vitamin K |
US5712356A (en) * | 1993-11-26 | 1998-01-27 | Ciba Vision Corporation | Cross-linkable copolymers and hydrogels |
US5607666A (en) * | 1993-12-22 | 1997-03-04 | L'oreal | Cosmetic or dermatological powder, its preparation process and its uses |
US5620692A (en) * | 1993-12-23 | 1997-04-15 | Nurture, Inc. | Oat oil compositions with useful cosmetic and dermatological properties |
US5607692A (en) * | 1993-12-30 | 1997-03-04 | L'oreal | Depigmenting composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof |
US5601833A (en) * | 1993-12-30 | 1997-02-11 | L'oreal | Protective, nutritive and/or firming composition for the simultaneous treatment of the surface layers and deep layers of the skin, and use thereof |
US5614215A (en) * | 1993-12-30 | 1997-03-25 | L'oreal | Cosmetic composition for the simultaneous treatment of the surface and deep layers of the skin, its use |
US5503832A (en) * | 1994-02-15 | 1996-04-02 | De Stoutz; Jean-Christian | Method for extracting the soluble material from oil-bearing beans or seeds |
US6045779A (en) * | 1994-02-18 | 2000-04-04 | Henkel Kommanditgesellschaft Auf Aktien | Skin and hair aerosol foam preparations containing an alkyl polyglycoside and vegetable oil |
US5505946A (en) * | 1994-04-01 | 1996-04-09 | Trustees Of Univ Of Pa | Bowman-birk inhibitor concentrate compositions and methods for the treatment of pre-malignant tissue |
US6013255A (en) * | 1994-04-18 | 2000-01-11 | Gist-Brocades B.V. | Stable water-in-oil emulsions |
US5885617A (en) * | 1994-07-12 | 1999-03-23 | Bpsi Holdings, Inc. | Moisture barrier film coating composition, method, and coated form |
US6033680A (en) * | 1994-12-06 | 2000-03-07 | The Procter & Gamble Company | Shelf stable skin cleansing liquid with gel forming polymer and lipid |
US6180662B1 (en) * | 1994-12-13 | 2001-01-30 | Beiersdorf Ag | Agents acting against hyperreactive and hypoactive, deficient skin conditions and manifest dermatitides |
US5723148A (en) * | 1995-01-05 | 1998-03-03 | Novartis Corp. | Topical pharmaceutical compositions |
US5618522A (en) * | 1995-01-20 | 1997-04-08 | The Procter & Gamble Company | Emulsion compositions |
US5885948A (en) * | 1995-02-15 | 1999-03-23 | The Procter & Gamble Company | Crystalline hydroxy waxes as oil in water stabilizers for skin cleansing liquid composition |
US5869031A (en) * | 1995-03-23 | 1999-02-09 | Pierre Fabre Dermo-Cosmetique | Depigmenting dermatological and/or cosmetic composition |
US6013250A (en) * | 1995-06-28 | 2000-01-11 | L'oreal S. A. | Composition for treating hair against chemical and photo damage |
US5885593A (en) * | 1995-09-28 | 1999-03-23 | The Andrew Jergens Company | Skin care composition including cyclodextrin materials and method for treating skin therewith |
US6019962A (en) * | 1995-11-07 | 2000-02-01 | The Procter & Gamble Co. | Compositions and methods for improving cosmetic products |
US5880314A (en) * | 1995-11-24 | 1999-03-09 | Mitsui Chemicals, Inc. | Hydrochalcone derivatives, cosmetic compositions containing said derivatives and methods of producing the same |
US5871823A (en) * | 1996-06-19 | 1999-02-16 | Huels Aktiengesellschaft | Hydrophilic coating of surfaces of polymeric substrates |
US5888522A (en) * | 1996-08-23 | 1999-03-30 | Skin Biology, Inc. | Tissue protective and regenerative compositions |
US5871743A (en) * | 1996-10-31 | 1999-02-16 | Chajuss; Daniel | Topical application of soy molasses |
US6018001A (en) * | 1997-01-23 | 2000-01-25 | Menicon Co., Ltd. | Process for producing contact lens with hydrophilic surface and contact lens obtained thereby |
US5863546A (en) * | 1997-03-02 | 1999-01-26 | Swinehart; James M | Cosmetic composition |
US5885600A (en) * | 1997-04-01 | 1999-03-23 | Burlington Bio-Medical & Scientific Corp. | Natural insect repellent formula and method of making same |
US6183762B1 (en) * | 1997-05-27 | 2001-02-06 | Sembiosys Genetics Inc. | Oil body based personal care products |
US5885596A (en) * | 1997-07-23 | 1999-03-23 | Bristol-Myers Squibb Company | Methods and compositions for fine lines and/or wrinkles |
US6017893A (en) * | 1997-08-29 | 2000-01-25 | Natures Sunshine Products, Inc. | Use of isoflavones to prevent hair loss and preserve the integrity of existing hair |
US6017549A (en) * | 1997-09-30 | 2000-01-25 | E-L Management Corp. | Non-irritating cosmetic and pharmaceutical compositions |
US6054137A (en) * | 1997-12-19 | 2000-04-25 | Societe L'oreal S.A. | Promoting epidermal renewal with phloroglucinol |
US6030931A (en) * | 1998-02-03 | 2000-02-29 | Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. | Foaming cleansing skin product |
US6051602A (en) * | 1998-03-16 | 2000-04-18 | The Procter & Gamble Company | Methods for regulating skin appearance |
US6183761B1 (en) * | 1998-03-16 | 2001-02-06 | The Procter & Gamble Company | Compositions for regulating skin appearance |
US20050036963A1 (en) * | 1998-07-06 | 2005-02-17 | Archana Sah | Compositions and methods for treating skin conditions |
US20040067244A1 (en) * | 1999-03-22 | 2004-04-08 | Friedman Doron I. | Nano oil in glycerin emulsion |
US20020034489A1 (en) * | 1999-06-10 | 2002-03-21 | Benjamin Wiegland | Personal care formulations |
US6551606B1 (en) * | 1999-06-10 | 2003-04-22 | Coty B.V. | Cosmetic product containing enzymes |
US20020035046A1 (en) * | 1999-07-01 | 2002-03-21 | Lukenbach Elvin R. | Personal care compositions |
US20030064048A1 (en) * | 1999-07-27 | 2003-04-03 | Miri Seiberg | Reducing hair growth, hair follicle and hair shaft size and hair pigmentation |
US20040009142A1 (en) * | 2000-07-26 | 2004-01-15 | Marie-France Zambaux | Synergistically active mixture which inhibits hair growth |
US20040062731A1 (en) * | 2000-10-27 | 2004-04-01 | Miri Seiberg | Topical anti-cancer compositions and methods of use thereof |
US20030064049A1 (en) * | 2000-10-27 | 2003-04-03 | Miri Seiberg | Topical anti-cancer compositions and methods of use thereof |
US6555143B2 (en) * | 2001-02-28 | 2003-04-29 | Johnson & Johnson Consumer Products, Inc. | Legume products |
US20050008665A1 (en) * | 2001-10-13 | 2005-01-13 | Beiersdorf Ag | Cosmetic or dermatological active ingredient combination |
US20050019279A1 (en) * | 2001-11-09 | 2005-01-27 | Beiersdorf Ag | Cosmetic or dermatological preparation containing an octadecene dioic acid and a UV filtering substance |
US20040063593A1 (en) * | 2002-09-30 | 2004-04-01 | Wu Jeffrey M. | Compositions containing a cosmetically active organic acid and a legume product |
US20050004561A1 (en) * | 2003-07-01 | 2005-01-06 | Lynn Halas | Method for removing hair |
US20070009459A1 (en) * | 2003-08-26 | 2007-01-11 | Stephanie Magnant | Stabilized antiperspirant compositions containing soy products |
US20070041931A1 (en) * | 2003-10-29 | 2007-02-22 | Muriel Morelli | Compositions Comprising Soy Products and Dioic Acids |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110081305A1 (en) * | 2009-10-02 | 2011-04-07 | Steven Cochran | Compositions comprising a skin-lightening resorcinol and a skin darkening agent |
EP2316411A2 (en) | 2009-10-02 | 2011-05-04 | Johnson & Johnson Consumer Companies, Inc. | Compositions comprising a skin-lightening resorcinol and a skin darkening agent |
US9289361B2 (en) | 2009-10-02 | 2016-03-22 | Johnson & Johnson Consumer Inc. | Compositions comprising an NFκB-inhibitor and a non-retinoid collagen promoter |
US9370474B2 (en) | 2009-10-02 | 2016-06-21 | Johnson & Johnson Consumer Inc. | High-clarity aqueous concentrates of 4-hexylresorcinol |
US9375395B2 (en) | 2009-10-02 | 2016-06-28 | Johnson & Johnson Consumer Inc. | Compositions comprising an NFκB-inhibitor and a tropoelastin promoter |
US9629794B2 (en) | 2009-10-02 | 2017-04-25 | Johnson & Johnson Consumer Inc. | Compositions comprising an NFκB-inhibitor and a tropoelastin promoter |
US10307352B2 (en) | 2012-09-24 | 2019-06-04 | Johnson & Johnson Consumer Inc. | Low oil compositions comprising a 4-substituted resorcinol and a high carbon chain ester |
WO2018162645A1 (en) | 2017-03-08 | 2018-09-13 | Amazentis Sa | Skin treatment methods |
Also Published As
Publication number | Publication date |
---|---|
DE69821913D1 (en) | 2004-04-01 |
HUP0000216A2 (en) | 2000-06-28 |
US8039026B1 (en) | 2011-10-18 |
US20120027706A1 (en) | 2012-02-02 |
JP2009114187A (en) | 2009-05-28 |
CN1234735A (en) | 1999-11-10 |
KR20000068645A (en) | 2000-11-25 |
BR9806118A (en) | 1999-08-31 |
AU8756698A (en) | 1999-02-16 |
ES2215317T3 (en) | 2004-10-01 |
HUP0000216A3 (en) | 2003-04-28 |
WO1999004752A2 (en) | 1999-02-04 |
DK0948308T3 (en) | 2004-06-14 |
ATE260083T1 (en) | 2004-03-15 |
KR100691395B1 (en) | 2007-03-09 |
WO1999004752A3 (en) | 1999-05-14 |
CA2267077C (en) | 2013-06-18 |
CA2267077A1 (en) | 1999-02-04 |
PL333284A1 (en) | 1999-11-22 |
CN1234735B (en) | 2015-09-16 |
DE69821913T2 (en) | 2004-12-23 |
BR9816322B1 (en) | 2014-07-15 |
PT948308E (en) | 2004-07-30 |
JP2001502360A (en) | 2001-02-20 |
ID22061A (en) | 1999-08-26 |
WO1999004752A9 (en) | 1999-04-08 |
EP0948308B1 (en) | 2004-02-25 |
IL129090A0 (en) | 2000-02-17 |
AR016780A1 (en) | 2001-08-01 |
JP4401441B2 (en) | 2010-01-20 |
EP0948308A1 (en) | 1999-10-13 |
TW557216B (en) | 2003-10-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8039026B1 (en) | Methods for treating skin pigmentation | |
US6750229B2 (en) | Methods for treating skin pigmentation | |
US6323219B1 (en) | Methods for treating immunomediated inflammatory disorders | |
EP2640346B1 (en) | Cosmetic compositions and methods for inhibiting or reducing trypsin activity based on cyclohexane-1,2,3,4,5,6-hexol and a n-acyl amino acid compound | |
CN109998938B (en) | Polypeptide composition for whitening, brightening and lightening spots | |
MXPA01006891A (en) | Soy depigmenting and skin care compositions. | |
JP5010582B2 (en) | Depigmenting or glossy cosmetic composition comprising at least one oxazoline as an active ingredient | |
AU2010249270B2 (en) | Methods for treating skin pigmentation | |
MXPA99003054A (en) | Methods for treating skin pigmentation | |
KR102561289B1 (en) | Peptide for whitening and cosmetic composition with improved percutaneous absorption comprising the same | |
CZ104699A3 (en) | Method of influencing skin pigmentation and composition for making the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |