WO2000020603A1 - Altered fatty acid biosynthesis in insect cells using delta five desaturase - Google Patents

Altered fatty acid biosynthesis in insect cells using delta five desaturase Download PDF

Info

Publication number
WO2000020603A1
WO2000020603A1 PCT/US1999/022692 US9922692W WO0020603A1 WO 2000020603 A1 WO2000020603 A1 WO 2000020603A1 US 9922692 W US9922692 W US 9922692W WO 0020603 A1 WO0020603 A1 WO 0020603A1
Authority
WO
WIPO (PCT)
Prior art keywords
oil
desaturase
group
acid
fraction
Prior art date
Application number
PCT/US1999/022692
Other languages
French (fr)
Inventor
Pradip Mukerji
Yung-Sheng Huang
Jennifer H. Parker-Barnes
Tapas Das
Original Assignee
Abbott Laboratories
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abbott Laboratories filed Critical Abbott Laboratories
Priority to AU65036/99A priority Critical patent/AU6503699A/en
Publication of WO2000020603A1 publication Critical patent/WO2000020603A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/92—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof
    • A61K8/927—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof of insects, e.g. shellac
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS, COOKING OILS
    • A23D9/00—Other edible oils or fats, e.g. shortenings, cooking oils
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/158—Fatty acids; Fats; Products containing oils or fats
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/115—Fatty acids or derivatives thereof; Fats or oils
    • A23L33/12—Fatty acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40—Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/67—Vitamins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A61K8/987—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin of species other than mammals or birds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083—Miscellaneous (1.14.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6472—Glycerides containing polyunsaturated fatty acid [PUFA] residues, i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • This invention relates to modulating levels of enzymes and/or enzyme components relating to production of long chain poly-unsaturated fatty acids (PUFAs) and ⁇ 5 desaturases in insects or animals.
  • PUFAs long chain poly-unsaturated fatty acids
  • PUFAs polyunsaturated fatty acids
  • EPA eicosapentaenoic acid
  • ARA arachidonic acid
  • PUFAs are important components of the plasma membrane of the cell, where they may be found in such forms as phospholipids. PUFAs are necessary for proper development, particularly in the developing infant brain, and for tissue formation and repair. PUFAs also serve as precursors to other molecules of importance in human beings and animals, including the prostacyclins, eicosanoids, leukotrienes and prostaglandins.
  • GLA docosahexaenoic acid
  • EPA gamma-linolenic acid
  • GLA gamma-linolenic acid
  • SDA stearidonic acid
  • GLA and another important long chain PUFA arachidonic acid (ARA) are found in filamentous fungi. ARA can be purified from animal tissues including liver and adrenal gland.
  • EPA and SDA are themselves, or are dietary precursors to, important long chain fatty acids involved in prostaglandin synthesis, in treatment of heart disease, and in development of brain tissue.
  • Polyunsaturated fatty acids have a number of pharmaceutical and medical applications including treatment of heart disease, cancer and arthritis.
  • DHA a number of sources exist for commercial production including a variety of marine organisms, oils obtained from cold water marine fish, and egg yolk fractions.
  • ARA microorganisms including the genera Mortierella, Entomophthora, Phytium and Porphyridium can be used for commercial production.
  • SDA include the genera Trichodesma and Echium.
  • GLA include evening primrose, black currants and borage.
  • the oils obtained from these sources therefore can require extensive purification to separate out one or more desired PUFAs or to produce an oil which is enriched in one or more PUFA.
  • Natural sources also are subject to uncontrollable fluctuations in availability. Fish stocks may undergo natural variation or may be depleted by overfishing. Fish oils have unpleasant tastes and odors, which may be impossible to economically separate from the desired product, and can render such products unacceptable as food supplements. Animal oils, and particularly fish oils, can accumulate environmental pollutants. Weather and disease can cause fluctuation in yields from both fish and plant sources. Cropland available for production of alternate oil-producing crops is subject to competition from the steady expansion of human populations and the associated increased need for food production on the remaining arable land.
  • Linolenic acid (LA, 18:2 ⁇ 9, 12) is produced from oleic acid (18:1 ⁇ 9) by a ⁇ 12- desaturase.
  • GLA (18:3 ⁇ 6, 9, 12) is produced from linoleic acid (LA, 18:2 ⁇ 9, 12) by a ⁇ 6-desaturase.
  • ARA (20:4 ⁇ 5, 8, 11, 14) production from dihomo- gamma-linolenic acid (DGLA, 20:3 ⁇ 8, 11, 14) is catalyzed by a ⁇ 5-desaturase.
  • ⁇ -linoleic acid (ALA, 18:3 ⁇ 9, 12, 15) cannot be synthesized by mammals.
  • eukaryotes including fungi and plants, have enzymes which desaturate at positions ⁇ 12 and ⁇ 15.
  • the major poly-unsaturated fatty acids of animals therefore are either derived from diet and/or from desaturation and elongation of linoleic acid (18:2 ⁇ 9, 12) or o -linolenic acid (18:3 ⁇ 9, 12, 15). Therefore it is of interest to obtain genetic material involved in PUFA biosynthesis from species that naturally produce these fatty acids and to express the isolated material in a microbial or animal system which can be manipulated to provide production of commercial quantities of one or more PUFAs.
  • PUFAs in a baculovirus expression system using cultured insect cells such as Spodoptera frugiperda (Sf9), army fallworm.
  • the lipid composition of Sf9 cells has been well characterized and are known to contain low proportions of polyunsaturated fatty acids.
  • production of PUFAs in insect cells would provide a good source of purified ⁇ 5 desaturases for use in enzyme studies and antibody production as well as a good source of PUFAs for use in various oils, nutritional supplements, cosmetic agents and the like.
  • compositions and methods are provided for preparation of polyunsaturated long chain fatty acids or PUFAs.
  • the compositions include nucleic acids encoding a ⁇ 5-desaturase and/or polypeptides having ⁇ 5-desaturase activity, the polypeptides, and probes for isolating and detecting the same.
  • the methods involve growing a host microorganism or animal which contains and expresses one or more transgenes encoding a ⁇ 5-desaturase and/or a polypeptide having ⁇ 5-desaturase activity.
  • the desaturase polypeptide provides for a relative increase in ⁇ 5-desaturated PUFA, or metabolic progeny therefrom, as a result of altered concentrations of enzymes and substrates involved in PUFA biosynthesis.
  • the invention finds use for example in the large scale production of PUFA containing oils which include, for example, ARA, EPA and/or DHA.
  • the invention is also directed to methods of producing purified ⁇ 5 desaturase in an insect cell culture system.
  • the purified protein can be used as an antigen for the production of polyclonal and monoclonal antibodies. These antibodies find use in methods of purifying the ⁇ 5 desaturases and in methods of detecting levels of ⁇ 5 desaturase polypeptide in complex solutions.
  • the purified ⁇ 5 desaturase protein also finds use in studies of the ⁇ 5 desaturase enzyme including X-ray crystal structures for structure-function studies. Once the purified protein has been studied in some detail, the enzyme can be modified by genetic engineering techniques to improve enzymatic activity and to alter substrate specificities.
  • a nucleic acid sequence comprising a ⁇ 5- desaturase depicted in Figure 3A-D (SEQ ID NO 1), a polypeptide encoded by the nucleic acid, and a purified or isolated polypeptide depicted in Figure 3A-D (SEQ ID NO: 2), and an isolated nucleic acid encoding the polypeptide of Figure 3A-D (SEQ ID NO: 2) are provided.
  • Another embodiment of the invention is an isolated nucleic acid sequence which encodes a polypeptide, wherein said polypeptide desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the molecule.
  • the nucleic acid is preferably derived from a eukaryotic cell, such as a fungal cell, or a fungal cell of the genus Mortierella, or of the genus/species Mortierella alpina. Also preferred is an isolated nucleic acid comprising a sequence which anneals to a nucleotide sequence depicted in Figure 3A-3D (SEQ ID NO: 1), and a nucleic acid which encodes an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2).
  • the nucleic acid encodes an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2) which is selected from the group consisting of amino acid residues 30-38, 41- 44, 171-175, 203-212, and 387-394.
  • the invention provides an isolated or purified polypeptide which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the molecule.
  • an isolated nucleic acid sequence which hybridizes to a nucleotide sequence depicted in Figure 3A-D (SEQ ID NO 1), an isolated nucleic acid sequence having at least about 50% identity to Figure 3A-D (SEQ ID NO 1).
  • the present invention further includes a nucleic acid construct comprising a nucleotide sequence depicted in a Figure 3A-D (SEQ ID NO: 1) linked to a heterologous nucleic acid; a nucleic acid construct comprising a nucleotide sequence depicted in a Figure 3A-D (SEQ ID NO: 1) operably linked to a promoter; and a nucleic acid construct comprising a nucleotide sequence -o-
  • the microbial cell is a yeast cell
  • the nucleotide sequence is derived from a fungus, such as a fungus of the genus Mortierella, particularly a fungus of the species Mortierella alpina.
  • a nucleic acid construct which comprises a nucleotide sequence which encodes a polypeptide comprising an amino acid sequence which corresponds to or is complementary to an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2), wherein the nucleotide sequence is operably linked to a promoter which is functional in a host cell, and wherein the nucleotide sequence encodes a polypeptide which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of a fatty acid molecule.
  • nucleic acid construct comprising a nucleotide sequence which encodes a functionally active ⁇ 5-desaturase, where the desaturase includes an amino acid sequence which corresponds to or is complementary to all of or a portion of an amino acid sequence depicted in a Figure 3A-D (SEQ ID NO: 2), wherein the nucleotide sequence is operably linked to a promoter functional in a host cell.
  • the invention also includes a host cell comprising a nucleic acid construct of the invention.
  • a recombinant host cell which comprises at least one copy of a DNA sequence which encodes a functionally active Mortierella alpina fatty acid desaturase having an amino acid sequence as depicted in Figure 3A-D (SEQ ID NO: 2), wherein the cell or an ancestor of the cell was transformed with a vector comprising said DNA sequence, and wherein the DNA sequence is operably linked to a promoter.
  • the host cell is either eukaryotic or prokaryotic.
  • Preferred eukaryotic host cells are those selected from the group consisting of a mammalian cell, an insect cell, a fungal cell, and an algae cell.
  • a preferred algae is a marine algae. Most preferred is an insect cell. Most preferred insect cells include fall army worm cells, Spodoptera frugiperda (Sf9 and Sf21 cells) and cabbage lopper moth, Trichoplusia ni (Hi Five Cells). Preferred prokaryotic cells include those selected from the group consisting of a bacteria, a cyanobacteria, cells which contain a bacteriophage, and/or a virus.
  • the DNA sequence of the recombinant host cell preferably contains a promoter which is functional in the host cell.
  • the host cells of the invention which contain the DNA sequences of the invention are enriched for fatty acids, such as 20:3 fatty acids.
  • the host cells are enriched for 20:4 fatty acids as compared to an un transformed host cell which is devoid of said DNA sequence, and/or enriched for 20:5 fatty acids compared to an untransformed host cell which is devoid of said DNA sequence.
  • the invention provides a recombinant host cell which comprises a fatty acid selected from the group consisting of a dihomo- ⁇ -linolenic acid, n-6 eicosatrienoic acid, 20:3n-6 acid and 20:3 (8,11,14) acid.
  • the present invention also includes method for production of arachidonic acid in a insect cell culture, where the method comprises growing an insect cell culture having a plurality of insect cells which contain one or more nucleic acids encoding a polypeptide which converts dihomo- ⁇ -linolenic acid to arachidonic acid, wherein the nucleic acid is operably linked to a promoter, under conditions whereby said one or more nucleic acids are expressed, whereby arachidonic acid is produced in the microbial cell culture.
  • the polypeptide is an enzyme which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the fatty acid molecule; the nucleic acid is derived from a Mortierella sp.; and the substrate for said polypeptide is exogenously supplied.
  • Preferred insect cells include spodoptera frugipera (Sf9 and Sf 21).
  • Preferred mammalian cells include an avian cell, a preferred fungal cell is a yeast, and the preferred algae cell is a marine algae cell.
  • the preferred prokaryotic cells include those selected from the group consisting of a bacteria, a cyanobacteria, cells which contain a bacteriophage, and/or a virus.
  • the nucleic acid sequence encoding the polypeptide of the microbial cell preferably contains a promoter which is functional in the host cell which optionally is an inducible promoter for example by components of the culture broth.
  • the preferred microbial cells used in the methods are yeast cells, such as Saccharomyces cells.
  • a recombinant yeast cell which converts greater than about 5% of 20:3 fatty acid substrate to a 20:4 fatty acid product.
  • an oil comprising one or more PUFA.
  • the amount of said one or more PUFAs is approximately 0.3-30% arachidonic acid (ARA), approximately 0.2-30% dihomo- ⁇ -linolenic acid (DGLA), and approximately 0.2-30% ⁇ -linolenic acid (GLA).
  • ARA arachidonic acid
  • DGLA dihomo- ⁇ -linolenic acid
  • GLA ⁇ -linolenic acid
  • a preferred oil of the invention is one in which the ratio of ARA:DGLA:GLA is approximately 1.0: 19.0:30 to
  • Another preferred embodiment of the invention is a pharmaceutical composition comprising the oils in a pharmaceutically acceptable carrier.
  • a nutritional composition comprising the oils of the invention.
  • the nutritional compositions of the invention preferably are administered to a mammalian host parenterally or internally.
  • a preferred composition of the invention for internal consumption is an infant formula.
  • the nutritional compositions of the invention are in a liquid form or a solid form.
  • the present invention also includes a method for desaturating a fatty acid, where the method comprises culturing a recombinant microbial cell of the invention under conditions suitable for expression of a polypeptide encoded by the nucleic acid, wherein the host cell further comprises a fatty acid substrate of the polypeptide.
  • a fatty acid desaturated by the methods is provided, including an oil comprising the fatty acid.
  • the present invention is also directed to purified nucleotide and peptide sequences presented in SEQ ID NO: 1-34.
  • the present invention is further directed toward methods of using the sequences presented in SEQ ID NO: 1-34 as probes to identify related sequences, as components of expression systems and as components of systems useful for producing transgenic oil.
  • the present invention is further directed to methods of obtaining altered long chain poly unsaturated fatty acid biosystems by growing transgenic microbes which encode transgene expression products which desaturate a fatty acid molecule at carbon 5 from the carboxyl end of the fatty acid molecule.
  • the present invention is further directed to formulas, dietary supplements or dietary substitutes in the form of a liquid or a solid containing the long chain fatty acids of the invention. These formulas, supplements and substitutes may be administered to a human or an animal.
  • the formulas, supplements of the invention may further comprise at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
  • at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
  • the formulas of the present invention may further include at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphorus, copper, chloride, iodine, selenium, and iron.
  • the present invention is further directed to a method of treating a patient having a condition caused by insufficient intake or production of polyunsaturated fatty acids comprising administering to the patient a dietary substitute of the invention in an amount sufficient to effect treatment of the patient.
  • the present invention is further directed to cosmetic and pharmaceutical compositions of the material of the invention.
  • the present invention is also directed to an isolated nucleotide sequence comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO:21; SEQ ID NO:22; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26 and SEQ ID NO:27.
  • the present invention is also directed to an isolated peptide sequence comprising a peptide sequence selected from the group consisting of: SEQ ID NO: 14; SEQ LD NO: 16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:28; SEQ ID O:29; SEQ ID NO:30; SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:33 and SEQ ID NO:34.
  • the present invention is further directed to transgenic oils in pharmaceutically acceptable carriers.
  • the present invention is further directed to nutritional supplements, cosmetic agents and infant formulae containing transgenic oils.
  • the present invention is further directed to a method for obtaining altered long chain polyunsaturated fatty acid biosynthesis comprising the steps of: growing a microbe having cells which contain a transgene which encodes a transgene expression product which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of said fatty acid molecule, wherein the transgene is operably associated with an expression control sequence, under conditions whereby the transgene is expressed, whereby long chain polyunsaturated fatty acid biosynthesis in the cells is altered.
  • the present invention is further directed to the use of chain polyunsaturated fatty acid selected from the group consisting of ARA, DGLA and EPA.
  • the present invention is further directed toward pharmaceutical compositions comprising at least one nutrient selected from the group consisting of a vitamin, a mineral, a carbohydrate, a sugar, an amino acid, a free fatty acid, a phospholipid, an antioxidant, and a phenolic compound.
  • Figure 1 shows possible pathways for the synthesis of arachidonic acid (20:4 ⁇ 5, 8, 11, 14) and stearidonic acid (18:4 ⁇ 6, 9, 12, 15) from palmitic acid (C ⁇ 6 ) from a variety of organisms, including algae, Mortierella and humans.
  • PUFAs can serve as precursors to other molecules important for humans and other animals, including prostacyclins, leukotrienes, and prostaglandins, some of which are shown.
  • Figure 2 shows possible pathways for production of PUFAs in addition to ARA, including EPA and DHA, for a variety of organisms.
  • Figure 3A-D shows the DNA sequence of the Mortierella alpina ⁇ 5- desaturase and the deduced amino acid sequence.
  • Figure 4 shows the deduced amino acid sequence of the PCR fragment (see Example 1)
  • Figure 5A and 5B show alignments of the protein sequence of the ⁇ 5- desaturase with ⁇ 6-desaturases.
  • Figure 6A and 6B show the effect of the timing of substrate addition relative to induction on conversion of substrate to product in SC334 containing the ⁇ 5-desaturase gene.
  • Figure 7A and 7B show the effect of inducer concentration on ⁇ 5- desaturase expression in SC334.
  • Figure 8A and 8B show the effect of induction temperature on ⁇ 5- desaturase activity in SC334.
  • Figure 9A and 9B show the effect of host strain on the conversion of substrate to product in strains expressing the ⁇ 5-desaturase gene at 15°C.
  • Figure 10A and 10B show the effect of host strain on the conversion of substrate to product in strains expressing the ⁇ 5-desaturase gene at 30°C.
  • Figure 11 shows the effect of a host strain expressing choline transferase as well as the ⁇ 5-desaturase gene on the conversion of substrate to product.
  • Figure 12A and 12B show the effect of media composition and temperature on the conversion of substrate to product in two host strains expressing the ⁇ 5-desaturase gene.
  • Figure 13 shows alignment of the protein sequence of Ma 29 and contig 253538a.
  • Figure 14 shows alignment of the protein sequence of Ma 524 and contig 253538a.
  • SEQ ID NO: 1 shows a DNA sequence of the Mortierella alpina ⁇ 5- desaturase.
  • SEQ ID NO:2 shows an amino acid sequence of Mortierella alpina ⁇ 5- desaturase.
  • SEQ ID NO: 3 shows the deduced amino acid sequence of the M. alpina PCR fragment (see Example 1).
  • SEQ LD NO: 4 - SEQ ID NO: 7 show the deduced amino acid sequences of various ⁇ 6-desaturases.
  • SEQ ID NO: 8 and SEQ ID NO: 9 show PCR primer sequences for ⁇ 6- desaturases
  • SEQ LD NO: 10 shows a primer for reverse transcription of total RNA.
  • SEQ LD NO: 11 and SEQ ID NO: 12 show amino acid motifs for desaturase sequences.
  • SEQ LD NO: 13 and SEQ ID NO: 14 show the nucleotide and amino acid sequence of a Dictyostelium discoideum desaturase sequence.
  • SEQ LD NO: 15 and SEQ ID NO: 16 show the nucleotide and amino acid sequence of a Phaeodactylum tricornutum desaturase sequence.
  • SEQ JD NO: 17-20 show the nucleotide and deduced amino acid sequence of a Schizochytrium cDNA clone.
  • SEQ JD NO: 21-27 show nucleotide sequences for human desaturases.
  • SEQ LD NO: 28 - SEQ ID NO: 34 show peptide sequences for human desaturases.
  • ⁇ 5-Desaturase is an enzyme which introduces a double bond between carbons 5 and 6 from the carboxyl end of a fatty acid molecule.
  • ⁇ 6-desaturase is an enzyme which introduces a double bond between carbons 6 and 7 from the carboxyl end of a fatty acid molecule.
  • ⁇ 9-desaturase is an enzyme which introduces a double bond between carbons 9 and 10 from the carboxyl end of a fatty acid molecule.
  • ⁇ l2-Desaturase is an enzyme which introduces a double bond between carbons 12 and 13 from the carboxyl end of a fatty acid molecule.
  • Fatty acids are a class of compounds containing a long hydrocarbon chain and a terminal carboxylate group. Fatty acids include the following:
  • the present invention is directed to novel DNA sequences, DNA constructs, methods and compositions are provided which permit modification of the poly-unsaturated long chain fatty acid content of, for example, microbial cells or animals.
  • Host cells are manipulated to express a sense or antisense transcript of a DNA encoding a polypeptide(s) which catalyzes the conversion of DGLA to ARA.
  • the substrate(s) for the expressed enzyme may be produced by the host cell or may be exogenously supplied.
  • the transformed DNA is operably associated with transcriptional and translational initiation and termination regulatory regions that are functional in the host cell. Constructs comprising the gene to be expressed can provide for integration into the genome of the host cell or can autonomously replicate in the host cell.
  • the expression cassettes generally used include a cassette which provides for ⁇ 5-desaturase activity, particularly in a host cell which produces or can take up DGLA.
  • Production of ⁇ 6-type unsaturated fatty acids, such as ARA is favored in a host microorganism or animal which is substantially free of ALA.
  • the host is selected or obtained by removing or inhibiting activity of a ⁇ 15 desaturase or a desaturase involved in the omega-3 pathway (see Figure 2).
  • the endogenous desaturase activity can be affected by providing an expression cassette for an antisense ⁇ 15 or ⁇ 3 transcript, by disrupting a target ⁇ 15- or cc>3- desaturase gene through insertion, substitution and/or deletion of all or part of the target gene, or by adding a ⁇ 15- or ⁇ 3 -desaturase inhibitor.
  • Production of LA also can be increased by providing expression cassettes for ⁇ 9 and/or ⁇ 12- desaturases where their respective enzymatic activities are limiting.
  • Insect cell production of fatty acids has several advantages over purification from natural sources such as fish or plants. Many insect cells are known with greatly simplified lipid compositions compared with those of higher organisms, making purification of desired components easier. Insect cell fatty acid production is not subject to fluctuations caused by external variables such as weather and food supply. Insect cell produced fatty acids are substantially free of contamination by environmental pollutants. Additionally, insect cells can provide PUFAs in particular forms which may have specific uses. Additionally, insect cell lipid production can be manipulated by controlling culture conditions, notably by providing particular substrates for microbially expressed enzymes, or by addition of compounds which suppress undesired biochemical pathways.
  • production of fatty acids from recombinant microbes provides the ability to alter the naturally occurring microbial fatty acid profile by providing new synthetic pathways in the host or by suppressing undesired pathways, thereby increasing levels of desired PUFAs, or conjugated forms thereof, and decreasing levels of undesired PUFAs.
  • Production of fatty acids in animals also presents several advantages.
  • Expression of desaturase genes in animals can produce greatly increased levels of desired PUFAs in animal tissues, making recovery from those tissues more economical.
  • desired PUFAs are expressed in the breast milk of animals
  • methods of isolating PUFAs from animal milk are well established.
  • animal breast milk can be manipulated through expression of desaturase genes, either alone or in combination with other human genes, to provide animal milks with a PUFA composition substantially similar to human breast milk during the different stages of infant development.
  • Humanized animal milks could serve as infant formulas where human nursing is impossible or undesired, or in cases of malnourishment or disease.
  • polypeptides Depending upon the host cell, the availability of substrate, and the desired end product(s), several polypeptides, particularly desaturases, are of interest.
  • desaturase is intended a polypeptide which can desaturate one or more fatty acids to produce a mono- or poly-unsaturated fatty acid or precursor thereof of interest.
  • polypeptides which can catalyze the conversion of DGLA to produce ARA which includes enzymes which desaturate at the ⁇ 5 position.
  • polypeptide is meant any chain of amino acids, regardless of length or post-translational modification, for example, glycosylation or phosphorylation.
  • a specific polypeptide having desaturase activity include the pH optimum of the polypeptide, whether the polypeptide is a rate limiting enzyme or a component thereof, whether the desaturase used is essential for synthesis of a desired polyunsaturated fatty acid, and/or co-factors required by the polypeptide.
  • the expressed polypeptide preferably has parameters compatible with the biochemical environment of its location in the host cell. For example, the polypeptide may have to compete for substrate with other enzymes in the host cell. Analyses of the K m and specific activity of the polypeptide in question therefore are considered in determining the suitability of a given polypeptide for modifying PUFA production in a given host cell.
  • the polypeptide used in a particular situation is one which can function under the conditions present in the intended host cell but otherwise can be any polypeptide having desaturase activity which has the desired characteristic of being capable of modifying the relative production of a desired PUFA.
  • the DNA sequence used encodes a polypeptide having ⁇ 5-desaturase activity.
  • this can be coupled with an expression cassette which provides for production of a polypeptide having ⁇ 6-desaturase activity and the host cell can optionally be depleted of any ⁇ 15- desaturase activity present, for example by providing a transcription cassette for production of antisense sequences to the ⁇ 15-desaturase transcription product, by disrupting the ⁇ 15-desaturase gene, or by using a host cell which naturally has, or has been mutated to have, low ⁇ 15-desaturase activity. Inhibition of undesired desaturase pathways also can be accomplished through the use of specific desaturase inhibitors such as those described in U.S. Patent No.
  • a key enzyme in this pathway is a ⁇ 5-desaturase which converts DH- ⁇ -linolenic acid (DGLA, eicosatrienoic acid) to ARA. Conversion of ⁇ -linolenic acid (ALA) to stearidonic acid by a ⁇ 6-desaturase is also shown. Production of PUFAs in addition to ARA, including EPA and DHA is shown in Figure 2.
  • a source of polypeptides having desaturase activity and oligonucleotides encoding such polypeptides are organisms which produce a desired polyunsaturated fatty acid.
  • microorganisms having an ability to produce ARA can be used as a source of ⁇ 5-desaturase activity.
  • Such microorganisms include, for example, those belonging to the genera Mortierella, Conidiobolus, Pythium, Phytophathora, Penicillium,
  • Porphyridium Coidosporium, Mucor, Fusarium, Aspergillus, Rhodotorula, and Entomophthora.
  • Porphyridium cruentum Within the genus Porphyridium, of particular interest is Porphyridium cruentum.
  • Mortierella Within the genus Mortierella, of particular interest are Mortierella elongata, Mortierella exigua, Mortierella hygrophila, Mortierella ramanniana, var. angulispora, and Mortierella alpina.
  • Mucor of particular interest are Mucor circinelloides and Mucor javanicus.
  • DNAs encoding desired desaturases can be identified in a variety of ways.
  • a source of the desired desaturase for example genomic or cDNA libraries from Mortierella
  • probes which can be made from DNA, RNA, or non- naturally occurring nucleotides, or mixtures thereof.
  • Probes may be enzymatically synthesized from DNAs of known desaturases for normal or reduced-stringency hybridization methods.
  • Oligonucleotide probes also can be used to screen sources and can be based on sequences of known desaturases, including sequences conserved among known desaturases, or on peptide sequences obtained from the desired purified protein.
  • Oligonucleotide probes based on amino acid sequences can be degenerate to encompass the degeneracy of the genetic code, or can be biased in favor of the preferred codons of the source organism. Oligonucleotides also can be used as primers for PCR from reverse transcribed mRNA from a known or suspected source; the PCR product can be the full length cDNA or can be used to generate a probe to obtain the desired full length cDNA. Alternatively, a desired protein can be entirely sequenced and total synthesis of a DNA encoding that polypeptide performed.
  • the desired genomic or cDNA can be sequenced by known methods. It is recognized in the art that such methods are subject to errors, such that multiple sequencing of the same region is routine and is still expected to lead to measurable rates of mistakes in the resulting deduced sequence, particularly in regions having repeated domains, extensive secondary structure, or unusual base compositions, such as regions with high GC base content. When discrepancies arise, resequencing can be done and can employ special methods.
  • Special methods can include altering sequencing conditions by using: different temperatures; different enzymes; proteins which alter the ability of oligonucleotides to form higher order structures; altered nucleotides such as ITP or methylated dGTP; different gel compositions, for example adding formamide; different primers or primers located at different distances from the problem region; or different templates such as single stranded DNAs. Sequencing of mRNA also can be employed.
  • the coding sequence for the polypeptide having desaturase activity is from a natural source. In some situations, however, it is desirable to modify all or a portion of the codons, for example, to enhance expression, by employing host preferred codons. Host preferred codons can be determined from the codons of highest frequency in the proteins expressed in the largest amount in a particular host species of interest.
  • the coding sequence for a polypeptide having desaturase activity can be synthesized in whole or in part. All or portions of the DNA also can be synthesized to remove any destabilizing sequences or regions of secondary structure which would be present in the transcribed mRNA.
  • All or portions of the DNA also can be synthesized to alter the base composition to one more preferable in the desired host cell. Methods for synthesizing sequences and bringing sequences together are well established in the literature. In vitro mutagenesis and selection, site-directed mutagenesis, or other means can be employed to obtain mutations of naturally occurring desaturase genes to produce a polypeptide having desaturase activity in vivo with more desirable physical and kinetic parameters for function in the host cell, such as a longer half-life or a higher rate of production of a desired polyunsaturated fatty acid.
  • the gene encoding the Mortierella alpina ⁇ 5-desaturase can be expressed in transgenic microorganisms or animals to effect greater synthesis of ARA from DGLA.
  • Other DNAs which are substantially identical to the Mortierella alpina ⁇ 5- desaturase DNA, or which encode polypeptides which are substantially identical to the Mortierella alpina ⁇ 5-desaturase polypeptide also can be used.
  • substantially identical is intended an amino acid sequence or nucleic acid sequence exhibiting in order of increasing preference at least 60%, 80%, 90% or 95% homology to the Mortierella alpina ⁇ 5-desaturase amino acid sequence or nucleic acid sequence encoding the amino acid sequence.
  • the length of comparison sequences generally is at least 16 amino acids, preferably at least 20 amino acids, or most preferably 35 amino acids.
  • the length of comparison sequences generally is at least 50 nucleotides, preferably at least 60 nucleotides, and more preferably at least 75 nucleotides, and most preferably, 110 nucleotides.
  • Homology typically is measured using sequence analysis software, for example, the Sequence Analysis software package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wisconsin 53705, MEGAlign (DNAStar, Inc., 1228 S. Park St., Madison, Wisconsin 53715), and Mac Vector (Oxford Molecular Group, 2105 S.
  • Conservative substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid, glutamic acid, asparagine, and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Substitutions may also be made on the basis of conserved hydrophobicity or hydrophilicity (Kyte and Doolittle, J. Mol. Biol. 157: 105-132, 1982), or on the basis of the ability to assume similar polypeptide secondary structure (Chou and Fasman, Adv. Enzymol. 47: 45-148, 1978).
  • ⁇ 5-desaturases from the same or other organisms.
  • Such related desaturases include variants of the disclosed ⁇ 5-desaturase naturally occurring within the same or different species of Mortierella, as well as homologues of the disclosed ⁇ 5-desaturase from other species.
  • desaturases which, although not substantially identical to the Mortierella alpina ⁇ 5-desaturase, desaturate a fatty acid molecule at carbon 5 from the carboxyl end of a fatty acid molecule.
  • Related desaturases can be identified by their ability to function substantially the same as the disclosed desaturases; that is, are still able to effectively convert DGLA to ARA.
  • desaturases also can be identified by screening sequence databases for sequences homologous to the disclosed desaturase, by hybridization of a probe based on the disclosed desaturase to a library constructed from the source organism, or by RT-PCR using mRNA from the source organism and primers based on the disclosed desaturase.
  • Such desaturases include those from humans, Dictyostelium discoideum and Phaeodactylum tricornum.
  • the regions of a desaturase polypeptide important for desaturase activity can be determined through routine mutagenesis, expression of the resulting mutant polypeptides and determination of their activities. Mutants may include deletions, insertions and point mutations, or combinations thereof.
  • a typical functional analysis begins with deletion mutagenesis to determine the N- and C- terminal limits of the protein necessary for function, and then internal deletions, insertions or point mutants are made to further determine regions necessary for function.
  • Other techniques such as cassette mutagenesis or total synthesis also can be used.
  • Deletion mutagenesis is accomplished, for example, by using exonucleases to sequentially remove the 5' or 3' coding regions. Kits are available for such techniques.
  • the coding region is completed by ligating oligonucleotides containing start or stop codons to the deleted coding region after 5' or 3' deletion, respectively.
  • oligonucleotides encoding start or stop codons are inserted into the coding region by a variety of methods including site-directed mutagenesis, mutagenic PCR or by ligation onto DNA digested at existing restriction sites. Internal deletions can similarly be made through a variety of methods including the use of existing restriction sites in the DNA, by use of mutagenic primers via site directed mutagenesis or mutagenic PCR. Insertions are made through methods such as linker-scanning mutagenesis, site-directed mutagenesis or mutagenic PCR. Point mutations are made through techniques such as site-directed mutagenesis or mutagenic PCR.
  • Chemical mutagenesis also can be used for identifying regions of a desaturase polypeptide important for activity.
  • a mutated construct is expressed, and the ability of the resulting altered protein to function as a desaturase is assayed.
  • Such structure-function analysis can determine which regions may be deleted, which regions tolerate insertions, and which point mutations allow the mutant protein to function in substantially the same way as the native desaturase. All such mutant proteins and nucleotide sequences encoding them are within the scope of the present invention.
  • the DNA encoding a desaturase polypeptide is placed in a vector capable of replication in a host cell, or is propagated in vitro by means of techniques such as PCR or long PCR.
  • Replicating vectors can include plasmids, phage, viruses, cosmids and the like.
  • Desirable vectors include those useful for mutagenesis of the gene of interest or for expression of the gene of interest in host cells.
  • the technique of long PCR has made in vitro propagation of large constructs possible, so that modifications to the gene of interest, such as mutagenesis or addition of expression signals, and propagation of the resulting constructs can occur entirely in vitro without the use of a replicating vector or a host cell.
  • a desaturase polypeptide For expression of a desaturase polypeptide, functional transcriptional and translational initiation and termination regions are operably linked to the DNA encoding the desaturase polypeptide. Expression of the polypeptide coding region can take place in vitro or in a host cell. Transcriptional and translational initiation and termination regions are derived from a variety of nonexclusive sources, including the DNA to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous locus in a host cell.
  • In vitro expression can be accomplished, for example, by placing the coding region for the desaturase polypeptide in an expression vector designed for in vitro use and adding rabbit reticulocyte lysate and cofactors; labeled amino acids can be incorporated if desired.
  • Such in vitro expression vectors may provide some or all of the expression signals necessary in the system used. These methods are well known in the art and the components of the system are commercially available.
  • the reaction mixture can then be assayed directly for the polypeptide, for example by determining its activity, or the synthesized polypeptide can be purified and then assayed.
  • Transient expression in a host cell can be accomplished in a transient or stable fashion.
  • Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not replicate and rarely integrate in the host cell, or where the host cell is not proliferating.
  • Transient expression also can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems frequently exhibit a low basal level of expression.
  • Stable expression can be achieved by introduction of a construct that can integrate into the host genome or that autonomously replicates in the host cell.
  • Stable expression of the gene of interest can be selected for through the use of a selectable marker located on or transfected with the expression construct, followed by selection for cells expressing the marker.
  • constructs When stable expression results from integration, integration of constructs can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, all or some of the transcriptional and translational regulatory regions can be provided by the endogenous locus.
  • the desaturase polypeptide in the source organism When increased expression of the desaturase polypeptide in the source organism is desired, several methods can be employed. Additional genes encoding the desaturase polypeptide can be introduced into the host organism. Expression from the native desaturase locus also can be increased through homologous recombination, for example by inserting a stronger promoter into the host genome to cause increased expression, by removing destabilizing sequences from either the mRNA or the encoded protein by deleting that information from the host genome, or by adding stabilizing sequences to the mRNA (USPN 4,910,141). When it is desirable to express more than one different gene, appropriate regulatory regions and expression methods, introduced genes can be propagated in the host cell through use of replicating vectors or by integration into the host genome.
  • each vector has a different means of replication.
  • Each introduced construct, whether integrated or not, should have a different means of selection and should lack homology to the other constructs to maintain stable expression and prevent reassortment of elements among constructs. Judicious choices of regulatory regions, selection means and method of propagation of the introduced construct can be experimentally determined so that all introduced genes are expressed at the necessary levels to provide for synthesis of the desired products.
  • Constructs comprising the gene of interest may be introduced into a host cell by standard techniques. These techniques include transformation, protoplast fusion, lipofection, transfection, transduction, conjugation, infection, holistic impact, electroporation, microinjection, scraping, or any other method which introduces the gene of interest into the host cell. Methods of transformation which are used include lithium acetate transformation (Methods in Enzymology, Vol. 194, p. 186-187, 1991). For convenience, a host cell which has been manipulated by any method to take up a DNA sequence or construct will be referred to as "transformed” or "recombinant" herein.
  • the subject host will have at least have one copy of the expression construct and may have two or more, depending upon whether the gene is integrated into the genome, amplified, or is present on an extrachromosomal element having multiple copy numbers.
  • the subject host is a yeast
  • four principal types of yeast plasmid vectors can be used: Yeast Integrating plasmids (Yips), Yeast Replicating plasmids (YRps), Yeast Centromere plasmids (YCps), and Yeast Episomal plasmids (YEps).
  • Yips lack a yeast replication origin and must be propagated as integrated elements in the yeast genome.
  • YRps have a chromosomally derived autonomously replicating sequence and are propagated as medium copy number (20 to 40), autonomously replicating, unstably segregating plasmids.
  • YCps have both a replication origin and a centromere sequence and propagate as low copy number (10-20), autonomously replicating, stably segregating plasmids.
  • YEps have an origin of replication from the yeast 2 ⁇ m plasmid and are propagated as high copy number, autonomously replicating, irregularly segregating plasmids. The presence of the plasmids in yeast can be ensured by maintaining selection for a marker on the plasmid.
  • yeast vectors pYES2 (a YEp plasmid available from Invitrogen, confers uracil prototrophy and a GAL1 galactose- inducible promoter for expression), pRS425-pGl (a YEp plasmid obtained from Dr. T. H. Chang, Ass. Professor of Molecular Genetics, Ohio State University, containing a constitutive GPD promoter and conferring leucine prototrophy), and pYX424 (a YEp plasmid having a constitutive TP1 promoter and conferring leucine prototrophy; Alber, T. and Kawasaki, G. (1982). J. Mol. & Appl. Genetics 1: 419).
  • the transformed host cell can be identified by selection for a marker contained on the introduced construct.
  • a separate marker construct may be introduced with the desired construct, as many transformation techniques introduce many DNA molecules into host cells.
  • transformed hosts are selected for their ability to grow on selective media. Selective media may incorporate an antibiotic or lack a factor necessary for growth of the untransformed host, such as a nutrient or growth factor.
  • An introduced marker gene therefor may confer antibiotic resistance, or encode an essential growth factor or enzyme, and permit growth on selective media when expressed in the transformed host. Selection of a transformed host also can occur when the expressed marker protein can be detected, either directly or indirectly.
  • the marker protein may be expressed alone or as a fusion to another protein.
  • the marker protein can be detected by its enzymatic activity; for example ⁇ galactosidase can convert the substrate X-gal to a colored product, and luciferase can convert luciferin to a light-emitting product.
  • the marker protein can be detected by its light-producing or modifying characteristics; for example, the green fluorescent protein of Aequorea victoria fluoresces when illuminated with blue light.
  • Antibodies can be used to detect the marker protein or a molecular tag on, for example, a protein of interest. Cells expressing the marker protein or tag can be selected, for example, visually, or by techniques such as FACS or panning using antibodies. For selection of yeast transformants, any marker that functions in yeast may be used. Desirably, resistance to kanamycin and the amino glycoside G418 are of interest, as well as ability to grow on media lacking uracil, leucine, lysine or tryptophan.
  • the ⁇ 5-desaturase-mediated production of PUFAs can be performed in either prokaryotic or eukaryotic host cells.
  • Prokaryotic cells of interest include Eschericia, Bacillus, Lactobacillus, cyanobacteria and the like.
  • Eukaryotic cells include mammalian cells such as those of lactating animals, avian cells such as of chickens, and other cells amenable to genetic manipulation including insect, fungal, and algae cells.
  • the cells may be cultured or formed as part or all of a host organism including an animal. Viruses and bacteriophage also may be used with the cells in the production of PUFAs, particularly for gene transfer, cellular targeting and selection.
  • the host is any microorganism or animal which produces DGLA and/or can assimilate exogenously supplied DGLA, and preferably produces large amounts of DGLA.
  • host animals include mice, rats, rabbits, chickens, quail, turkeys, bovines, sheep, pigs, goats, yaks, etc., which are amenable to genetic manipulation and cloning for rapid expansion of the transgene expressing population.
  • a ⁇ 5-desaturase transgene can be adapted for expression in target organdies, tissues and body fluids through modification of the gene regulatory regions. Of particular interest is the production of PUFAs in the breast milk of the host animal.
  • Production of PUFAs in insect cells can be conducted using baculovirus expression vectors harboring a ⁇ 5-desaturase transgene as detailed in the Example section below.
  • host systems include Spodoptera frugiperda, (Sf9 and Sf21 cells) and cabbag lopper moth Trichoplusia ni (Hi Five Cells).
  • Baculovirus expression systems are high level gene expression systems capable of post translational modifications similar to mammalian cells.
  • the expression system allows for genetic manipulation with relative ease in comparison to mammalian cell transfections.
  • site-specific transposition and eliminating the potential mix of parental and nonrecombinant baculoviruses there is no need for multiple rounds of plaque purification. This greatly reduces the time it takes to identify and purify a recombinant virus.
  • This system also offers the advantage of supporting coexpression of gene products encoded by different recombinant baculovirus vectors in a single infection.
  • transgenic marine algae may be prepared as described in USPN 5,426,040.
  • the timing, extent of expression and activity of the desaturase transgene can be regulated by fitting the polypeptide coding sequence with the appropriate transcriptional and translational regulatory regions selected for a particular use.
  • promoter regions which can be induced under preselected growth conditions. For example, introduction of temperature sensitive and/or metabolite responsive mutations into the desaturase transgene coding sequences, its regulatory regions, and/or the genome of cells into which the transgene is introduced can be used for this purpose.
  • the transformed host cell is grown under appropriate conditions adapted for a desired end result.
  • the conditions are typically optimized to produce the greatest or most economical yield of PUFAs, which relates to the selected desaturase activity.
  • Media conditions which may be optimized include: carbon source, nitrogen source, addition of substrate, final concentration of added substrate, form of substrate added, aerobic or anaerobic growth, growth temperature, inducing agent, induction temperature, growth phase at induction, growth phase at harvest, pH, density, and maintenance of selection.
  • Microorganisms of interest, such as yeast and algae are preferably grown in selected medium.
  • complex media such as peptone broth (YPD) or a defined media such as a minimal media (contains amino acids, yeast nitrogen base, and ammonium sulfate, and lacks a component for selection, for example uracil) are preferred.
  • substrates to be added are first dissolved in ethanol.
  • expression of the polypeptide of interest may be induced, for example by including or adding galactose to induce expression from a GAL promoter.
  • Transient expression can be accomplished via known methods, for example infection or lipofection, and can be repeated in order to maintain desired expression levels of the introduced construct (see Ebert, PCT publication WO 94/05782).
  • Stable expression can be accomplished via integration of a construct into the host genome, resulting in a transgenic animal.
  • the construct can be introduced, for example, by microinjection of the construct into the pronuclei of a fertilized egg, or by transfection, retroviral infection or other techniques whereby the construct is introduced into a cell line which may form or be incorporated into an adult animal (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S.
  • the recombinant eggs or embryos are transferred to a surrogate mother (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S. Patent No. 5,565,362; U.S. Patent No. 5,366,894; Wilmut et al. (supra)).
  • transgenic animals are identified, for example, by the presence of an introduced marker gene, such as for coat color, or by PCR or Southern blotting from a blood, milk or tissue sample to detect the introduced construct, or by an immunological or enzymological assay to detect the expressed protein or the products produced therefrom (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S. Patent No. 5,565,362; U.S. Patent No. 5,366,894; Wilmut et al. (supra)).
  • the resulting transgenic animals may be entirely transgenic or may be mosaics, having the transgenes in only a subset of their cells.
  • the desaturase transgene can be adapted for expression so that it is retained in the mammary cells, or secreted into milk, to form the PUFA reaction products localized to the milk (PCT publication WO 95/24488).
  • Expression can be targeted for expression in mammary tissue using specific regulatory sequences, such as those of bovine ⁇ -lactalbumin, ⁇ -casein, ⁇ - casein, ⁇ -casein, ⁇ -casein, ⁇ -lactoglobulin, or whey acidic protein, and may optionally include one or more introns and/or secretory signal sequences (U.S. Patent No. 5,530,177; Rosen, U.S. Patent No. 5,565,362; Clark et al, U.S. Patent No.
  • Recombinant ⁇ 5 desaturase may be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography and hydrophobic interaction chromatography. Insect cell produced ⁇ 5 desaturase is a particularly good source of the purified enzyme. The purified ⁇ 5 desaturase may be used for the production of monoclonal and polyclonal antibodies.
  • recombinant ⁇ 5 desaturase can be separated from other cellular proteins by use of an immuno-affmity column made with monoclonal or polyclonal antibodies specific for full length ⁇ 5 desaturase or polypeptide fragments of ⁇ 5 desaturase.
  • Monospecific antibodies to ⁇ 5 desaturase are purified from mammalian antisera containing antibodies reactive against ⁇ 5 desaturase or are prepared as monoclonal antibodies reactive with ⁇ 5 desaturase, using procedures well known in the art such as the technique of Kohler and Milstein, Nature 256: 495-497 (1975).
  • Monospecific antibody as used herein is defined as a single antibody species with homogenous binding characteristics for ⁇ 5 desaturase.
  • Homogenous binding as used herein refers to the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with the ⁇ 5 desaturase, as described above.
  • ⁇ 5 desaturase specific antibodies are raised by immunizing animals such as mice, rate, guinea pigs, rabbits, goats, horses and the like, with an appropriate concentration of ⁇ 5 desaturase either with or without an immune adjuvant.
  • Preimmune serum is collected prior to the first immunization.
  • Each animal receives between about 0.1 ⁇ g and about 1000 ⁇ g of ⁇ 5 desaturase associated with an acceptable immune adjuvant.
  • acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum- precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA.
  • the initial immunization consists of the ⁇ 5 desaturase protein in, preferably, Freund's complete adjuvant at multiple sites either subcutaneously (SC), intraperitoneally (IP) or both.
  • SC subcutaneously
  • IP intraperitoneally
  • Each animal is bled at regular intervals, preferably weekly, to determine antibody titer.
  • the animals may or may not receive booster injections following the initial immunization. Those animals receiving booster injections are generally given an equal amount of ⁇ 5 desaturase in Freund's incomplete adjuvant by the same route. Booster injections are given at about three week intervals until the maximal titers are obtained. At about 7 days after each booster immunization or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about -20° C.
  • Monoclonal antibodies (mAb) reactive with ⁇ 5 desaturase are prepared by immunizing inbred mice, preferably Balb/c, with purified ⁇ 5 desaturase .
  • the mice are immunized by the IP or SC route with about 1 ⁇ g to about 100 ⁇ g, preferably about 10 ⁇ g, of ⁇ 5 desaturase in about 0.5 ml buffer or saline incorporated in an equal volume of an acceptable adjuvant, as discussed above. Freund's complete adjuvant is preferred.
  • the mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks.
  • Immunized mice are given one or more booster immunizations of about 1 to about 100 ⁇ g of ⁇ 5 desaturase in a buffer solution such as phosphate buffered saline by the intravenous (LV) route.
  • Lymphocytes from antibody positive mice, preferably splenic lymphocytes, are obtained by removing spleens from immunized mice by standard procedures known in the art.
  • Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner, preferably myeloma cells, under conditions which will allow the formation of stable hybridomas. Fusion partners may include, but are not limited to: mouse myelomas P3/NSl/Ag 4-1; MPC-11; S-104 and Sp 2/0, with Sp 2/0 being preferred.
  • the antibody producing cells and myeloma cells are fused in polyethylene glycol, about 1000 mol. wt., at concentrations from about 30% to about 50%.
  • Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art.
  • DMEM Dulbecco's Modified Eagles Medium
  • Supernatant fluids are collect from growth positive wells on about days 14, 18 and 21 and are screened for ⁇ 5 desaturase antibody production by an immunoassay such as solid phase immunoradioassay (SPLRA) using ⁇ 5 desaturase as the antigen.
  • SPLRA solid phase immunoradioassay
  • Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973.
  • Monoclonal antibodies are produced in vivo by injection of pristane primed Balb/c mice, approximately 0.5 ml per mouse, with about 2 x 10 6 to about 6 x 10 6 hybridoma cells about 4 days after priming. Ascites fluid is collected at approximately 8-12 days after cell transfer and the monoclonal antibodies are purified by techniques known in the art.
  • In vitro production of anti- ⁇ 5 desaturase mAb is carried out by growing the hydridoma in DMEM containing about 2% fetal calf serum to obtain sufficient quantities of the specific mAb.
  • the mAb are purified by techniques known in the art.
  • Antibody titers of ascites or hybridoma culture fluids are determined by various serological or immunological assays which include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique and radioimmunoassay (RIA) techniques. Similar assays are used to detect the presence of ⁇ 5 desaturases in body fluids or tissue and cell extracts.
  • serological or immunological assays include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique and radioimmunoassay (RIA) techniques. Similar assays are used to detect the presence of ⁇ 5 desaturases in body fluids or tissue and cell extracts.
  • ⁇ 5 desaturase antibody affinity columns are made by adding the antibodies to Affigel-10 (Biorad), a gel support which is pre-activated with N- hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support.
  • the antibodies are then coupled to the gel via amide bonds with the spacer arm.
  • the remaining activated esters are then quenched with 1M ethanolamine HCI (pH 8).
  • the column is washed with water followed by 0.23M glycine HCI (pH 2.6) to remove any non-conjugated antibody or extraneous protein.
  • the column is then equilibrated in phosphate buffered saline (pH 7.3) and the cell culture supernatants or cell ex tracts containing ⁇ 5 desaturase or ⁇ 5 desaturase fragments are slowly passed through the column.
  • the column is then washed with phospate buffered saline until the optical density (A280) falls to background, then the protein is eluted with 0.23M glycine-HCI (pH 2.6).
  • the purified ⁇ 5 desaturase protein is then dialyzed against phosphate buffered saline.
  • the fatty acids desaturated in the ⁇ 5 position may be found in the host microorganism or animal as free fatty acids or in conjugated forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and may be extracted from the host cell through a variety of means well-known in the art. Such means may include extraction with organic solvents, sonication, supercritical fluid extraction using for example carbon dioxide, and physical means such as presses, or combinations thereof. Of particular interest is extraction with methanol and chloroform. Where desirable, the aqueous layer can be acidified to protonate negatively charged moieties and thereby increase partitioning of desired products into the organic layer. After extraction, the organic solvents can be removed by evaporation under a stream of nitrogen.
  • the products When isolated in conjugated forms, the products may be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subject to further manipulations to produce a desired end product.
  • conjugated forms of fatty acids are cleaved with potassium hydroxide.
  • Such methods may include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, high speed centrifugation or distillation, or combinations of these techniques.
  • Protection of reactive groups may be done at any step through known techniques, for example alkylation or iodination.
  • Methods used include methylation of the fatty acids to produce methyl esters.
  • protecting groups may be removed at any step.
  • purification of fractions containing ARA, DHA and EPA may be accomplished by treatment with urea and/or fractional distillation.
  • Probes based on the DNAs of the present invention may find use in methods for isolating related molecules or in methods to detect organisms expressing desaturases.
  • the DNAs or oligonucleotides When used as probes, the DNAs or oligonucleotides must be detectable. This is usually accomplished by attaching a label either at an internal site, for example via inco ⁇ oration of a modified residue, or at the 5' or 3' terminus.
  • Such labels can be directly detectable, can bind to a secondary molecule that is detectably labeled, or can bind to an unlabelled secondary molecule and a detectably labeled tertiary molecule; this process can be extended as long as is practical to achieve a satisfactorily detectable signal without unacceptable levels of background signal.
  • Secondary, tertiary, or bridging systems can include use of antibodies directed against any other molecule, including labels or other antibodies, or can involve any molecules which bind to each other, for example a biotin-streptavidin/avidin system.
  • Detectable labels typically include radioactive isotopes, molecules which chemically or enzymatically produce or alter light, enzymes which produce detectable reaction products, magnetic molecules, fluorescent molecules or molecules whose fluorescence or light-emitting characteristics change upon binding. Examples of labelling methods can be found in USPN 5,011,770.
  • the binding of target molecules can be directly detected by measuring the change in heat of solution on binding of probe to target via isothermal titration calorimetry, or by coating the probe or target on a surface and detecting the change in scattering of light from the surface produced by binding of target or probe, respectively, as may be done with the BIAcore system.
  • PUFAs produced by recombinant means find applications in a wide variety of areas. Supplementation of humans or animals with PUFAs in various forms can result in increased levels not only of the added PUFAs, but of their metabolic progeny as well. For example, where the inherent ⁇ 5-desaturase pathway is dysfunctional in an individual, treatment with ARA can result not only in increased levels of ARA, but also of downstream products of ARA such as prostaglandins (see Figure 1). Complex regulatory mechanisms can make it desirable to combine various PUFAs, or to add different conjugates of PUFAs, in order to prevent, control or overcome such mechanisms to achieve the desired levels of specific PUFAs in an individual.
  • the present invention also includes fatty acid compositions such as nutritional compositions.
  • Such compositions include any food or preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function.
  • the nutritional composition of the present invention comprises at least one oil or acid produced in accordance with the present invention and may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins and minerals in amounts desired for a particular use. The amount of such ingredients will vary depending on whether the composition is intended for use with normal, healthy infants, children or adults having specialized needs such as those which accompany certain metabolic conditions (e.g., metabolic disorders).
  • macronutrients which may be added to the composition include but are not limited to edible fats, carbohydrates and proteins.
  • examples of such edible fats include but are not limited to coconut oil, soy oil, and mono- and diglycerides.
  • examples of such carbohydrates include but are not limited to glucose, edible lactose and hydrolyzed starch.
  • examples of proteins which may be utilized in the nutritional composition of the invention include but are not limited to soy proteins, electrodialysed whey , electrodialysed skim milk, milk whey, or the hydrolysates of these proteins.
  • vitamins and minerals may be added to the nutritional compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
  • the components utilized in the nutritional compositions of the present invention will of semi-purified or purified origin.
  • semi-purified or purified is meant a material which has been prepared by purification of a natural material or by synthesis.
  • Examples of nutritional compositions of the present invention include but are not limited to infant formulas, dietary supplements, and rehydration compositions.
  • Nutritional compositions of particular interest include but are not limited to those utilized for enteral and parenteral supplementation for infants, specialist infant formulae, supplements for the elderly, and supplements for those with gastrointestinal difficulties and/or malabsorption.
  • a typical nutritional composition of the present invention will contain edible macronutrients, vitamins and minerals in amounts desired for a particular use.
  • the amounts of such ingredients will vary depending on whether the formulation is intended for use with normal, healthy individuals temporarily exposed to stress, or to subjects having specialized needs due to certain chronic or acute disease states (e.g., metabolic disorders).
  • the components utilized in a nutritional formulation of the present invention are of semi-purified or purified origin.
  • semi-purified or purified is meant a material that has been prepared by purification of a natural material or by synthesis.
  • a nutritional formulation of the present invention is an enteral nutritional product, more preferably an adult or child enteral nutritional product. Accordingly in a further aspect of the invention, a nutritional formulation is provided that is suitable for feeding adults, who are experiencing stress.
  • the formula comprises, in addition to the PUFAs of the invention; macronutrients, vitamins and minerals in amounts designed to provide the daily nutritional requirements of adults.
  • the macronutritional components include edible fats, carbohydrates and proteins.
  • Exemplary edible fats are coconut oil, soy oil, and mono- and diglycerides and the PUFA oils of this invention.
  • Exemplary carbohydrates are glucose, edible lactose and hydrolyzed cornstarch.
  • a typical protein source would be soy protein, electrodialysed whey or electrodialysed skim milk or milk whey, or the hydrolysates of these proteins, although other protein sources are also available and may be used.
  • These macronutrients would be added in the form of commonly accepted nutritional compounds in amount equivalent to those present in human milk or an energy basis, i.e., on a per calorie basis.
  • the enteral formula can be sterilized and subsequently utilized on a ready-to-feed (RTF) basis or stored in a concentrated liquid or a powder.
  • the powder can be prepared by spray drying the enteral formula prepared as indicated above, and the formula can be reconstituted by rehydrating the concentrate.
  • Adult and infant nutritional formulas are well known in the art and commercially available (e.g., Similac®, Ensure®, Jevity® and Alimentum® from Ross Products Division, Abbott Laboratories).
  • An oil or acid of the present invention can be added to any of these formulas in the amounts described below.
  • the energy density of the nutritional composition when in liquid form can typically range from about 0.6 Kcal to 3.0 Kcal per ml.
  • the nutritional supplement can contain from about 1.2 to more than 9 Kcals per gm, preferably 3 to 7 Kcals per gram.
  • the osmolality of a liquid product should be less than 700 mOsm and more preferably less than 660 mOsm.
  • the nutritional formula would typically include vitamins and minerals, in addition to the PUFAs of the invention, in order to help the individual ingest the minimum daily requirements for these substances.
  • the presence of zinc, copper or folic acid is optional and is not required in order to gain the beneficial effects on immune suppression.
  • a pharmaceutical composition can be supplemented with these same substances as well.
  • the nutritional contains, in addition to the antioxidant system and the PUFA component, a source of carbohydrate wherein at least 5 weight % of said carbohydrate is an indigestible oligosaccharide.
  • the nutritional composition additionally contains protein, taurine and carnitine.
  • human breast milk has a fatty acid profile comprising from about 0.15 % to about 0.36 % as DHA, from about 0.03 % to about 0.13 % as EPA, from about 0.30 % to about 0.88 % as ARA, from about 0.22 % to about 0.67 % as DGLA, and from about 0.27 % to about 1.04 % as GLA.
  • fatty acids such as ARA, DGLA, GLA and/or EPA produced by the invention can be used to alter the composition of infant formulas to better replicate the PUFA composition of human breast milk.
  • an oil composition for use in a pharmacologic or food supplement, particularly a breast milk substitute or supplement will preferably comprise one or more of ARA, DGLA and GLA. More preferably the oil will comprise from about 0.3 to 30% ARA, from about 0.2 to 30% DGLA, and from about 0.2 to about 30% GLA.
  • the ratios of ARA, DGLA and GLA can be adapted for a particular given end use.
  • an oil composition which contains two or more of ARA, DGLA and GLA will be provided in a ratio of about 1 : 19:30 to about 6: 1:0.2, respectively.
  • the breast milk of animals can vary in ratios of ARA:DGLA:DGL ranging from 1:19:30 to 6: 1:0.2, which includes intermediate ratios which are preferably about 1:1:1, 1:2:1, 1:1:4.
  • adjusting the rate and percent of conversion of a precursor substrate such as GLA and DGLA to ARA can be used to precisely control the PUFA ratios.
  • a 5% to 10% conversion rate of DGLA to ARA can be used to produce an ARA to DGLA ratio of about 1: 19, whereas a conversion rate of about 75% to 80% can be used to produce an ARA to DGLA ratio of about 6: 1. Therefore, whether in a cell culture system or in a host animal, regulating the timing, extent and specificity of desaturase expression as described can be used to modulate the PUFA levels and ratios.
  • the oils also can be isolated and recombined in the desired concentrations and ratios. Amounts of oils providing these ratios of PUFA can be determined following standard protocols.
  • PUFAs, or host cells containing them also can be used as animal food supplements to alter an animal's tissue or milk fatty acid composition to one more desirable for human or animal consumption.
  • the purified PUFAs may be incorporated into cooking oils, fats or margarines formulated so that in normal use the recipient would receive the desired amount.
  • the PUFAs may also be incorporated into infant formulas, nutritional supplements or other food products, and may find use as anti-inflammatory or cholesterol lowering agents.
  • the present invention also encompasses a pharmaceutical composition
  • a pharmaceutical composition comprising one or more of the acids and/or resulting oils produced in accordance with the methods described herein.
  • a pharmaceutical composition may comprise one or more of the acids and/or oils as well as a standard, well-known, non-toxic pharmaceutically acceptable carrier, adjuvant or vehicle such as, for example, phosphate buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent or an emulsion such as a water/oil emulsion.
  • the composition may be in either a liquid or solid form.
  • the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectible, or topical ointment or cream.
  • Possible routes of administration include, for example, oral, rectal and parenteral.
  • the route of administration will, of course, depend upon the desired effect. For example, if the composition is being utilized to treat rough, dry, or aging skin, to treat injured or burned skin, or to treat skin or hair affected by a disease or condition, it may perhaps be applied topically.
  • the dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient, age of the patient, immune status of the patient, etc.
  • the composition may be, for example, a solution, a dispersion, a suspension, an emulsion or a sterile powder which is then reconstituted.
  • composition of the present invention may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic compositions such that a mixture is formed or may be used as a sole composition.
  • the topical compositions into which PUFAs are formulated comprise a cosmetic or dermatological composition and can be provided in all conventional pharmaceutical dosage forms for topical application and the physiologically acceptable vehicle, diluent or carrier and therefore can be any standard vehicle or medium for a cosmetic or dermatological composition.
  • compositions can be formulated as an aqueous solution, or an oily suspension, or a dispersion of the lotion or serum type, or as an emulsion having a liquid or semi-liquid consistency of the milk type, obtained by dispersion of a fatty phase into an aqueous phase (O/W) or vice-versa (W/O), or as a suspension or emulsion having a soft consistency of the aquenous gel or cream type, or as microcapsules or microparticles, or as vesicular dispersions of ionic and/or nonionic type.
  • These compositions are formulated according to the usual techniques.
  • the amounts of the different constituents of the compositions are those conventionally employed in the fields under consideration.
  • the subject compositions constitute, in particular, cleansing, protection, treatment or care creams for the face, for the hands, for the major anatomical folds or for the body (for example day creams, night creams, makeup removal creams, foundation creams or anti-sun or sunscreen creams), fluid foundations, makeup removal milks, protection or care body milks, anti-sun or sunscreen milks, or lotions, gels or foams for caring for the skin, such as cleansing lotions, anti-sun lotions, artificial tanning lotions, and the like.
  • cleansing, protection, treatment or care creams for the face, for the hands, for the major anatomical folds or for the body for example day creams, night creams, makeup removal creams, foundation creams or anti-sun or sunscreen creams), fluid foundations, makeup removal milks, protection or care body milks, anti-sun or sunscreen milks, or lotions, gels or foams for caring for the skin, such as cleansing lotions, anti-sun lotions, artificial tanning lotions, and the like.
  • the proportion of the fatty phase can range from 5% to 80% by weight and preferably from 5% to 50% by weight with respect to the total weight of the composition.
  • the oils, waxes, emulsifiers and coemulsifiers formulated into the composition in the emulsion form are those conventional in the cosmetics field.
  • the emulsifier and the coemulsifier are advantageously present in such compositions in a proportion ranging from 0.3% to 30% by weight and preferably from 0.5% to 20% by weight with respect to the total weight of the composition.
  • the emulsion can, in addition, contain lipid vesicles.
  • the subject cosmetic or dermatological compositions can also contain adjuvants and additives usual in the cosmetics or dermatological field, such as hydrophilic or lipopyhilic gelling agents, hydrophilic or lipophilic additives, preservatives, antioxidants, solvents, fragrances, fillers, screening agents, odor absorbers and colorants.
  • adjuvants and additives usual in the cosmetics or dermatological field, such as hydrophilic or lipopyhilic gelling agents, hydrophilic or lipophilic additives, preservatives, antioxidants, solvents, fragrances, fillers, screening agents, odor absorbers and colorants.
  • the amounts of these different adjuvants and additives are those conventional in these fields and, for example, range from 0.01% to 10% of the total weight of the composition.
  • These adjuvants and additives depending on their nature, can be introduced into the fatty phase, into the aqueous phase and/or into lipid spherules.
  • oils and waxes include mineral oils (liquid petrolatum), vegetable oils (liquid fraction of karite butter, sunflower oil), animal oils (perhydrosqualene), synthetic oils (Purcellin oil), silicone oils or waxes (cyclomethicone) and fluorinated oils (perfluoropolyethers), beeswax or carnauba or parafin wax. Fatty alcohols and fatty acids (stearic acid) can be added to these oils.
  • Exemplary emulsifiers include, for example, glycerol stearate, polysorbate 60 and the PEG-6/PEG-31 /glycol stearate mixture marketed under the trademark Tefose " 63 by Gattefosse.
  • Exemplary hydrophilic gelling agents according to the invention include the carboxyvinyl polymers (carbomer), acrylic copolymers, such as acrylate/alkyl acrylate copolymers, polyacrylamides, polysaccharides, such as hydroxypropylcellulose, natural gums and clays, and exemplary lipophilic gelling agents include the modified clays, such as bentones, or metal salts of fatty acids, such as aluminum stearates.
  • the compositions of the present invention can contain other active ingredients suitable, in particular, for the prevention and/or for the treatment of skin conditions/afflictions.
  • compositions according to the invention are particularly well suited for preventing or treating oxidative stress of the skin and/or or its adnexa, in aprticular related to UV irradiation, to aging, to inflammation, to alopecia, and the like.
  • compositions may be utilized to administer the PUFA component to an individual.
  • Suitable pharmaceutical compositions may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions and sterile powders for reconstitution into sterile solutions or dispersions for ingestion.
  • suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents, for example sugars, sodium chloride and the like. Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents.
  • Suspensions in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth or mixtures of these substances, and the like.
  • suspending agents as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth or mixtures of these substances, and the like.
  • Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art.
  • PUFAs of the invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid and a lubricant such as stearic acid or magnesium stearate.
  • Capsules can be prepared by incorporating these excipients into a gelatin capsule along with the antioxidants and the PUFA component. The amount of the antioxidants and PUFA component that should be incorporated into the pharmaceutical formulation should fit within the guidelines discussed above.
  • the term “treat” refers to either preventing, or reducing the incidence of, the undesired occurrence.
  • to treat immune suppression refers to either preventing the occurrence of this suppression or reducing the amount of such suppression.
  • patient and “individual” are being used interchangeably and both refer to an animal.
  • animal as used in this application refers to any warm-blooded mammal including, but not limited to, dogs, humans, monkeys, and apes.
  • the term “about” refers to an amount varying from the stated range or number by a reasonable amount depending upon the context of use. Any numerical number or range specified in the specification should be considered to be modified by the term about.
  • Dose and serving are used interchangeably and refer to the amount of the nutritional or pharmaceutical composition ingested by the patient in a single setting and designed to deliver effective amounts of the antioxidants and the structured triglyceride.
  • a single dose or serving of the liquid nutritional powder should supply the amount of antioxidants and PUFAs discussed above.
  • the amount of the dose or serving should be a volume that a typical adult can consume in one sitting. This amount can vary widely depending upon the age, weight, sex or medical condition of the patient.
  • a single serving or dose of a liquid nutritional produce should be considered as encompassing a volume from 100 to 600 ml, more preferably from 125 to 500 ml and most preferably from 125 to 300 ml.
  • the PUFAs of the present invention may also be added to food even when supplementation of the diet is not required.
  • the composition may be added to food of any type including but not limited to margarines, modified butters, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
  • compositions are generally administered orally but can be administered by any route by which they may be successfully absorbed, e.g., parenterally (i.e. subcutaneously, intramuscularly or intravenously), rectally or vaginally or topically, for example, as a skin ointment or lotion.
  • parenterally i.e. subcutaneously, intramuscularly or intravenously
  • rectally or vaginally or topically for example, as a skin ointment or lotion.
  • the PUFAs of the present invention may be administered alone or in combination with a pharmaceutically acceptable carrier or excipient. Where available, gelatin capsules are the preferred form of oral administration. Dietary supplementation as set forth above also can provide an oral route of administration.
  • the unsaturated acids of the present invention may be administered in conjugated forms, or as salts, esters, amides or prodrugs of the fatty acids.
  • any pharmaceutically acceptable salt is encompassed by the present invention; especially preferred are the sodium, potassium or lithium salts.
  • the N-alkylpolyhydroxamine salts such as N-methyl glucamine, found in PCT publication WO 96/33155.
  • the preferred esters are the ethyl esters.
  • the PUFAs also can be administered in tablet form.
  • the PUFAs or derivatives thereof may be incorporated into commercial formulations such as Intralipids.
  • the typical normal adult plasma fatty acid profile comprises 6.64 to 9.46% of ARA, 1.45 to 3.11% of DGLA, and 0.02 to 0.08% of GLA.
  • PUFAs or their metabolic precursors can be administered, either alone or in mixtures with other PUFAs, to achieve a normal fatty acid profile in a patient.
  • the individual components of formulations may be individually provided in kit form, for single or multiple use.
  • a typical dosage of a particular fatty acid is from 0.1 mg to 20 g, or even 100 g daily, and is preferably from 10 mg to 1, 2, 5 or 10 g daily as required, or molar equivalent amounts of derivative forms thereof.
  • Parenteral nutrition compositions comprising from about 2 to about 30 weight percent fatty acids calculated as triglycerides are encompassed by the present invention; preferred is a composition having from about 1 to about 25 weight percent of the total PUFA composition as GLA (USPN 5,196,198).
  • Other vitamins, and particularly fat-soluble vitamins such as vitamin A, D, E and L-carnitine can optionally be included.
  • a preservative such as ⁇ tocopherol may be added, typically at about 0.1% by weight.
  • Suitable pharmaceutical compositions may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions and sterile powders for reconstitution into sterile injectible solutions or dispersions.
  • suitable aqueous and non-aqeuous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propylleneglyol, polyethylenegycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ehyl oleate.
  • Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • compositions can also include isotonic agents, for example sugars, sodium chloride and the like.
  • the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents.
  • Suspensions in addition to the active compounds may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances and the like.
  • An especially preferred pharmaceutical composition contains diacetyltartaric acid esters of mono- and diglycerides dissolved in an aqueous medium or solvent.
  • Diacetyltartaric acid esters of mono- and diglycerides have an HLB value of about 9-12 and are significantly more hydrophilic than existing antimicrobial lipids that have HLB values of 2-4.
  • Those existing hydrophobic lipids cannot be formulated into aqueous compositions. As disclosed herein, those lipids can now be solubilized into aqueous media in combination with diacetyltartaric acid esters of mono-and diglycerides.
  • diacetyltartaric acid esters of mono- and diglycerides e.g., DATEM-C12:0
  • other active antimicrobial lipids e.g., 18:2 and 12:0 monoglycerides
  • the mixture can be completely dispersed in water. This is not possible without the addition of diacetyltartaric acid esters of mono- and diglycerides and premixing with other monoglycerides prior to introduction into water.
  • the aqueous composition can then be admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants as may be required to form a spray or inhalant.
  • the present invention also encompasses the treatment of numerous disorders with fatty acids.
  • Supplementation with PUFAs of the present invention can be used to treat restenosis after angioplasty. Symptoms of inflammation, rheumatoid arthritis, and asthma and psoriasis can be treated with the PUFAs of the present invention.
  • the PUFAs of the present invention can be used in the treatment of cancer.
  • Malignant cells have been shown to have altered fatty acid compositions; addition of fatty acids has been shown to slow their growth and cause cell death, and to increase their susceptibility to chemotherapeutic agents.
  • GLA has been shown to cause reexpression on cancer cells of the E-cadherin cellular adhesion molecules, loss of which is associated with aggressive metastasis.
  • Clinical testing of intravenous administration of the water soluble lithium salt of GLA to pancreatic cancer patients produced statistically significant increases in their survival.
  • PUFA supplementation may also be useful for treating cachexia associated with cancer.
  • the PUFAs of the present invention can also be used to treat diabetes (USPN 4,826,877; Horrobin et al, Am. J. Clin.
  • the PUFAs of the present invention can be used to treat eczema, reduce blood pressure and improve math scores.
  • Essential fatty acid deficiency has been suggested as being involved in eczema, and studies have shown beneficial effects on eczema from treatment with GLA.
  • GLA has also been shown to reduce increases in blood pressure associated with stress, and to improve performance on arithmetic tests.
  • GLA and DGLA have been shown to inhibit platelet aggregation, cause vasodilation, lower cholesterol levels and inhibit proliferation of vessel wall smooth muscle and fibrous tissue (Brenner et al., Adv. Exp. Med. Biol. Vol. 83, p. 85-101, 1976).
  • GLA or DGLA has been shown to reduce or prevent gastro-intestinal bleeding and other side effects caused by non-steroidal anti- inflammatory drugs (USPN 4,666,701).
  • GLA and DGLA have also been shown to prevent or treat endometriosis and premenstrual syndrome (USPN 4,758,592) and to treat myalgic encephalomyelitis and chronic fatigue after viral infections (USPN 5,116,871).
  • PUFAs of this invention include use in treatment of AIDS, multiple schlerosis, acute respiratory syndrome, hypertension and inflammatory skin disorders.
  • the PUFAs of the inventions also can be used for formulas for general health as well as for geriatric treatments.
  • compositions may be utilized in connection with animals, as well as humans, as animals experience many of the same needs and conditions as human.
  • oil or acids of the present invention may be utilized in animal feed supplements.
  • Example 15 Nutritional Compositions
  • Example 1 Isolation of a ⁇ 5-desaturase Nucleotide Sequence from Mortierella alpina
  • ortierella alpina produces arachidonic acid (ARA, 20:4) from the precursor 20:3 by a ⁇ 5-desaturase.
  • ARA arachidonic acid
  • a nucleotide sequence encoding the ⁇ 5- desaturase from Mortierella alpina was obtained through PCR amplification using M. alpina 1 st strand cDNA and degenerate oligonucleotide primers corresponding to amino acid sequences conserved between ⁇ 6-desaturases from Synechocystis and Spirulina. The procedure used was as follows:
  • RNA 5 ⁇ g of total RNA was reverse transcribed using BRL Superscript RTase and the primer TSyn (5'-CCAAGCTTCTGCAGGAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3'), SEQ ID NO: 10.
  • TSyn 5'-CCAAGCTTCTGCAGGAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3'
  • TSyn 5'-CCAAGCTTCTGCAGGAGCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  • PCR amplification was carried out in a 25 ⁇ l volume containing: template derived from 40 ng total RNA, 2 pM each primer, 200 ⁇ M each deoxyribonucleotide triphosphate, 60 mM Tris-Cl, pH 8.5, 15 mM (NH 4 ) SO 4 , 2 mM MgCl .
  • the PCR product was used as a probe to isolate corresponding cDNA clones from a M. alpina library.
  • the longest cDNA clone, Ma29 was designated pCGN5521 and has been completely sequenced on both strands.
  • the cDNA is contained as a 1481 bp insert in the vector pZLl (Bethesda Research Laboratories) and, beginning with the first ATG, contains an open reading frame encoding 446 amino acids. The reading frame contains the sequence deduced from the PCR fragment.
  • the sequence of the cDNA insert was found to contain regions of homology to ⁇ 6-desaturases (see Figure 5).
  • the Mortierella cDNA clone appears to represent a fusion between a cytochrome b5 and a fatty acid desaturase. Since cytochrome b5 is believed to function as the electron donor for membrane- bound desaturase enzymes, it is possible that the N-terminal cytochrome b5 domain of this desaturase protein is involved in its function. This may be advantageous when expressing the desaturase in heterologous systems for PUFA production.
  • Lithium acetate transformation of yeast was performed according to standard protocols (Methods in Enzymology, Vol. 194, p. 186-187, 1991).
  • yeast were grown in YPD at 30°C.
  • Cells were spun down, resuspended in TE, spun down again, resuspended in TE containing 100 mM lithium acetate, spun down again, and resuspended in TE/lithium acetate.
  • the resuspended yeast were incubated at 30°C for 60 minutes with shaking.
  • Carrier DNA was added, and the yeast were aliquoted into tubes.
  • Transforming DNA was added, and the tubes were incubated for 30 min. at 30°C.
  • PEG solution (35% (w/v) PEG 4000, 100 mM lithium acetate, TE pH7.5) was added followed by a 50 min. incubation at 30°C.
  • a 5 min. heat shock at 42°C was performed, the cells were pelleted, washed with TE, pelleted again and resuspended in TE.
  • the resuspended cells were then plated on selective media.
  • the cDNA clones from Mortierella alpina were screened for desaturase activity in baker's yeast.
  • a canola ⁇ 15-desaturase obtained by PCR using 1 st strand cDNA from Brassica napus cultivar 212/86 seeds using primers based on the published sequence (Arondel et al. Science 258: 1353-1355) was used as a positive control.
  • the ⁇ 15-desaturase gene and the gene from cDNA clone Ma29 was inserted into the expression vector pYES2 (Invitrogen), resulting in plasmids pCGR-2 and pCGR-4, respectively. These plasmids were transfected into S.
  • the cerevisiae yeast strain 334 was expressed after induction with galactose and in the presence of substrates that allowed detection of specific desaturase activity.
  • the control strain was S. cerevisiae strain 334 containing the unaltered pYES2 vector.
  • the substrates used, the products produced and the indicated desaturase activity were: DGLA (conversion to ARA would indicate ⁇ 5- desaturase activity), linolenic acid (conversion to GLA would indicate ⁇ 6- desaturase activity; conversion to ALA would indicate ⁇ 15-desaturase activity), oleic acid (an endogenous substrate made by S. cerevisiae, conversion to linolenic acid would indicate ⁇ 12-desaturase activity, which S. cerevisiae lacks), or ARA (conversion to EPA would indicate ⁇ 17-desaturase activity).
  • the results are provided in Table 1 below.
  • the lipid fractions were extracted as follows: Cultures were grown for 48-52 hours at 15°C. Cells were pelleted by centrifugation, washed once with sterile ddH 2 0, and repelleted. Pellets were vortexed with methanol; chloroform was added along with tritridecanoin (as an internal standard). The mixtures were incubated for at least one hour at room temperature or at 4°C overnight. The chloroform layer was extracted and filtered through a Whatman filter with one gram of anhydrous sodium sulfate to remove particulates and residual water. The organic solvents were evaporated at 40°C under a stream of nitrogen.
  • the extracted lipids were then derivatized to fatty acid methyl esters (FAME) for gas chromatography analysis (GC) by adding 2 ml of 0.5 N potassium hydroxide in methanol to a closed tube. The samples were heated to 95°C to 100°C for 30 minutes and cooled to room temperature. Approximately 2 ml of 14 % boron trifluoride in methanol was added and the heating repeated. After the extracted lipid mixture cooled, 2 ml of water and 1 ml of hexane were added to extract the FAME for analysis by GC. The percent conversion was calculated by dividing the product produced by the sum of (the product produced and the substrate added) and then multiplying by 100. To calculate the oleic acid percent conversion, as no substrate was added, the total linolenic acid produced was divided by the sum of (oleic acid and linolenic acid produced), then multiplying by 100. Table 1
  • the ⁇ 15-desaturase control clone exhibited 16.3% conversion of the substrate.
  • the pCGR-4 clone expressing the Ma29 cDNA converted 15.3% of the 20:3 substrate to 20:4 ⁇ 6, indicating that the gene encodes a ⁇ 5-desaturase.
  • the background (non-specific conversion of substrate) was between 0-3% in these cases.
  • substrate inhibition of the activity was using different concentrations of the substrate. When substrate was added to 100 ⁇ M, the percent conversion to product dropped compared to when substrate was added to 25 ⁇ M (see below). Additionally, by varying the DGLA substrate concentrations, between about 5 ⁇ M to about 200 ⁇ M percent conversion of DGLA to ARA ranged from about 5% to 75% with the M.
  • alpina ⁇ 5- desaturase alpina ⁇ 5- desaturase.
  • Table 2 represents fatty acids of interest as a percent of the total lipid extracted from the yeast host S. cerevisiae 334 with the indicated plasmid. No glucose was present in the growth media. Affinity gas chromatography was used to separate the respective lipids. GC/MS was employed to verify the identity product(s). The expected product for the B. napus ⁇ 15-desaturase, ⁇ - linolenic acid, was detected when its substrate, linolenic acid, was added exogenously to the induced yeast culture.
  • yeast expression of a desaturase gene can produce functional enzyme and detectable amounts of product under the current growth conditions.
  • Both exogenously added substrates were taken up by yeast, although slightly less of the longer chain PUFA, dihomo- ⁇ -linolenic acid (20:3), was incorporated into yeast than linolenic acid (18:2) when either was added in free form to the induced yeast cultures.
  • Arachidonic acid was detected as a novel PUFA in yeast when dihomo- ⁇ -linolenic acid was added as the substrate to S. cerevisiae 334 (pCGR- 4). This identifies pCGR-4 (MA29) as the ⁇ 5-desaturase from M. alpina. Prior to this, no isolation and expression of a ⁇ 5-desaturase from any source has been reported.
  • Table 3 A shows the effect of exogenous free fatty acid substrate concentration on yeast uptake and conversion to fatty acid product as a percentage of the total yeast lipid extracted.
  • low amounts of exogenous substrate (1-10 ⁇ M) resulted in low fatty acid substrate uptake and product formation.
  • concentration of free fatty acid in the growth and induction media gave the highest percentage of fatty acid product formed, while the 100 ⁇ M concentration and subsequent high uptake into yeast appeared to decrease or inhibit the desaturase activity.
  • the feedback inhibition of high fatty acid substrate concentration was well illustrated when the percent conversion rates of the respective fatty acid substrates to their respective products were compared in Table 3B. In all cases, 100 ⁇ M substrate concentration in the growth media decreased the percent conversion to product.
  • Table 4 shows the amount of fatty acid produced by a recombinant desaturase from induced yeast cultures when different amounts of free fatty acid substrate were used. Fatty acid weight was determined since the total amount of lipid varied dramatically when the growth conditions were changed, such as the presence of glucose in the yeast growth and induction media. To better determine the conditions when the recombinant desaturase would produce the most PUFA product, the quantity of individual fatty acids were examined. The absence of glucose reduced the amount of arachidonic acid produced by ⁇ 5-desaturase by half. For ⁇ 5-desaturase the amount of total yeast lipid was decreased by almost half in the absence of glucose.
  • Table 5 illustrates the uptake of free fatty acids and their new products formed in yeast lipids as distributed in the major lipid fractions.
  • a total lipid extract was prepared as described above.
  • the lipid extract was separated on TLC plates, and the fractions were identified by comparison to standards. The bands were collected by scraping, and internal standards were added. The fractions were then saponified and methylated as above, and subjected to gas chromatography.
  • the gas chromatograph calculated the amount of fatty acid by comparison to a standard. It would appear that the substrates are accessible in the phospholipid form to the desaturases. Table 5 Fatty Acid Distribution in Various Yeast Lipid Fractions in ⁇ g
  • the substrate was added either 15 hours before induction or concomitant with inducer addition (indicated as after, in Figure 6A). As it can be seen in Figure 6A, addition of substrate before induction did not have a significant effect on the activity of ⁇ 5-desaturase. In fact, addition of substrate along with the inducer was slightly better for expression activity of ⁇ 5-desaturase, as ARA levels in the total fatty acids were higher.
  • yeast strain on expression of the ⁇ 5-desaturase gene was studied in 5 different host strains; LNVSC 1 , LNVSC2, YTC34, YTC41 , and SC334, at 15°C and 30°C.
  • SC334 has the highest percentage of ARA in total fatty acids, suggesting higher activity of ⁇ 5-desaturase in SC334.
  • the rate of conversion of substrate to product is lowest in SC334 and highest in LNVSC 1 (Fig. 9A and B).
  • the highest percentage of product (ARA) in total fatty acids was observed in LNVSC2, although the rate of conversion of substrate to product in LNVSC2 was slightly lower than LNVSCl (Fig. 10A and B).
  • ARA the product of ⁇ 5 -desaturase
  • yeast host strain DBY746 obtained from the Yeast Genetic Stock Centre, 1021 Donner Laboratory, Berkeley, CA 94720.
  • the genotype of strain DBY746 is Mat ⁇ , his3- ⁇ l, leu2-3, leu2-l 12, ura3-32, t ⁇ l-289, gal).
  • the DBY746 yeast strain has an endogenous gene for choline transferase.
  • the presence of this enzyme might enable the DB Y746 strain to convert excess phospholipids into triglycerides fraction.
  • Results in Fig. 11 show no increase in the conversion of substrate to product as compared to SC334, which does not have the gene for choline transferase.
  • pCGR4/SC334 was grown in four different media at two different temperatures
  • composition of the media was as follows:
  • Results show that the highest conversion rate of substrate to product at 15°C in SC334 was observed in media A.
  • the highest conversion rate overall for ⁇ 5-desaturase in SC334 was at 30° in media D.
  • the highest conversion rate of ⁇ 5- desaturase in LNVSC 1 was also at 30° in media D ( Figures 12A and 12B).
  • Insect cells were used as another eukaryotic host for expression of the M. alpina D5-desaturase.
  • the baculovirus expression system involves the use of insect cells to express a gene, in this case the M. alpina D5-desaturase, which has been cloned into a baculovirus expression vector.
  • Insect cells are known to have no endogenous PUFA desaturase activities. Therefore, this system is suitable for expression and characterization of the recombinant desaturases.
  • the fragment containing the D5-desaturase gene (pCGR4, see Example 2) was PCR amplified using Expand High Fidelity PCR System (Boehringer
  • the upstream primer designated RO651 (5'- ATACCGGAATTCGCCGCCACCATGGGAACGGACCAAGGAAAAAC), SEQ ID NO: 35 corresponded to the sense strand of D5 cDNA and contained an EcoRI site 5' upstream of the ATG.
  • the downstream primer RO652 (5'-
  • SEQ ID NO: 36 corresponded to the antisense strand at the 3' end of the D5 cDNA, and included an Xhol site immediately downstream of the translational termination codon.
  • the PCR reaction in a final volume of 100 ⁇ l, was carried out for 30 cycles in temperature conditions of 45 seconds at 94° C, 45 seconds at 55 °C and 2 min at
  • the D5 PCR amplified product was analyzed by agarose-gel electrophoresis, gel purified, digested with EcoRI and Xhol, and then ligated into pFastBacl baculovirus donor plasmid (Gibco-BRL, Gaithersburg, MD) which was restricted with the same enzymes.
  • the respective baculovirus clone was designated as pJPB5 for the D5-desaturase.
  • This pFastBacl vector contains an expression cassette which has a polyhedrin promoter, a SV40 polyadenylation signal, and a gentamycin resistance marker.
  • the initial transformation was done in XL1 blue cells (Invitrogen, Carlsbad, CA). Positive clones were then transformed into E. coli DHlOBac (Gibco-BRL, Gaithersburg, MD) which contains the baculovirus genome. The positive clones were selected by blue white screening in which white colonies contain the recombinant bacmid. White colonies were then selected for bacmid DNA isolation. DNA was isolated using a Qiagen plasmid isolation kit (Qiagen Inc., Valencia, CA), specific for DNA over 135 kb long. The recombinant DNA bacmid was analyzed on a 0.6% agarose gel to confirm the presence of the high molecular weight DNA. PCR analysis, using pUC/M 13 primers (forward 5'-
  • TGTAAAACGACGGCCAGT SEQ ID NO: 37 and reverse 5'- GAAACAGCTATGACCATG) SEQ ID NO: 38 was also performed to confirm the correct insert size for the desaturase cDNA within the bacmid.
  • Sf9 insect cells Spodoptera frugiperda
  • Sf900 serum free media
  • the Sf9 cells were plated at a concentration of 1x106 cells/well in a 6- well tissue culture plate and infected with lOOul of the virus stock (approximately 5 MOI).
  • the substrate, dihomo-gamma-linolenic acid (DGLA, C20:3n-6) was supplemented at the time of infection, at a concentration of 25 ⁇ M.
  • DGLA, C20:3n-6 dihomo-gamma-linolenic acid
  • the medium was collected 48 hours post infection and saved.
  • the cells were collected and submitted for lipid analysis.
  • fatty acid analysis For fatty acid analysis, cell pellets were vortexed with 6 ml of methanol, followed by the addition of 12 ml of chloroform and tridecanoin (as internal standard). The mixtures were incubated for at least one hour at room temperature or at 4°C overnight. The chloroform layer was extracted and filtered through a Whatman filter with one gram of anhydrous sodium sulfate to remove particulates and residual water. The organic solvents were evaporated at 400 °C under a stream of nitrogen. The extracted lipids were derivatized to fatty acid methyl esters (FAME) for gas chromatography analysis (GC) by adding 2 ml of 0.5N potassium hydroxide in methanol to a closed tube.
  • FAME fatty acid methyl esters
  • GC gas chromatography analysis
  • the samples were heated at 95 to 100°C for 30 minutes and cooled to room temperature. Approximately 2 ml of the 14% boron triflouride in methanol was added and the heating repeated. After the extracted lipid mixture cooled, 2 ml of water and 1 ml of hexane were added to extract the FAME for GC analysis. The percent conversion was calculated by dividing the product produced by the sum of (the product produced and the substrate) and then multiplying by 100.
  • the fatty acid synthesis in insect cells infected with recombinant virus containing D5 cDNA is summarized in Table 6.
  • the conversion of the added substrate, DGLA, to Arachidonic acid (AA, 20:4n-6) was monitored.
  • AA, and other fatty acids containing longer carbon chains, were detected in the presence of the recombinant fungal D5-desaturase enzyme.
  • the quantity of arachidonic acid (AA, 20:4n-6) produced by the D5-desaturase was 1.4% of the total fatty acid versus the control which expressed only 0.175% . This resulted in a 23% conversion of DGLA to AA.
  • M. alpina D5-desaturase can be expressed in another eukaryotic host (insect cells) in a biologically active form as demonstrated by the production of AA as well as the accumulation of fatty acids with longer carbon chains.
  • a nucleic acid sequence that encodes a putative ⁇ 5 desaturase was identified through a TBLASTN search of the est databases through NCBI using amino acids 100-446 of Ma29 as a query. The truncated portion of the Ma29 sequence was used to avoid picking up homologies based on the cytochrome b5 portion at the N-terminus of the desaturase.
  • the deduced amino acid sequence of an est from Dictyostelium discoideum shows very significant homology to Ma29 and lesser, but still significant homology to Ma524.
  • the DNA sequence is presented as SEQ ID NO: 13.
  • the amino acid sequence is presented as
  • a cDNA library was constructed from total RNA isolated from Phaeodactylum tricornutum.
  • a plasmid-based cDNA library was constructed in pSPORTl (GIBCO-BRL) following manufacturer's instructions using a commercially available kit (GLBCO-BRL). Random cDNA clones were sequenced and nucleic acid sequences that encode putative ⁇ 5 or ⁇ 6 desaturases were identified through
  • a cDNA library was constructed from total RNA isolated from Schizochytrium species.
  • a plasmid-based cDNA library was constructed in pSPORTl (GLBCO-BRL) following manufacturer's instructions using a commercially available kit (GLBCO-BRL). Random cDNA clones were sequenced and nucleic acid sequences that encode putative ⁇ 5 or ⁇ 6 desaturases were identified through BLAST search of the databases and comparison to Ma29 and Ma524 sequences.
  • the DNA sequence from the reverse primer is presented as SEQ ID NO: 19.
  • the amino acid sequence from the reverse primer is presented as SEQ ID NO:20.
  • Human desaturase gene sequences potentially involved in long chain polyunsaturated fatty acid biosynthesis were isolated based on homology between the human cDNA sequences and Mortierella alpina desaturase gene sequences. The three conserved "histidine boxes" known to be conserved among membrane- bound desaturases were found. As with some other membrane-bound desaturases the final HXXHH histidine box motif was found to be QXXHH.
  • the amino acid sequence of the putative human desaturases exhibited homology to M. alpina ⁇ 5, ⁇ 6, ⁇ 9, and ⁇ 12 desaturases. The M.
  • alpina ⁇ 5 desaturase and ⁇ 6 desaturase cDNA sequences were used to search the LifeSeq database of Incyte Pharmaceuticals, Inc., Palo Alto, California 94304.
  • the ⁇ 5 desaturase sequence was divided into fragments; 1) amino acid no. 1-150, 2) amino acid no. 151-300, and 3) amino acid no. 301-446.
  • the ⁇ 6 desaturase sequence was divided into three fragments; 1) amino acid no. 1-
  • the polypeptide fragments 2 and 3 of M. alpina ⁇ 5 and ⁇ 6 have homologies with the ClonelD sequences as outlined in Table 6.
  • the Clone Information Results displayed the information including the ClusterlD, ClonelD, Library, HitID, Hit Description.
  • the ClusterlD number displayed the clone information of all the clones that belong in that ClusterlD.
  • the Assemble command assembles all of the ClonelD which comprise the ClusterlD. The following default settings were used for GCG
  • Gap Weight 8 Length Weight: 2 GCG Assembly Results displayed the contigs generated on the basis of sequence information within the ClonelD.
  • a contig is an alignment of DNA sequences based on areas of homology among these sequences.
  • a new sequence (consensus sequence) was generated based on the aligned DNA sequences within a contig.
  • the contig containing the ClonelD was identified, and the ambiguous sites of the consensus sequence was edited based on the alignment of the ClonelDs (see SEQ LD NO:21 - SEQ ID NO:25) to generate the best possible sequence.
  • the procedure was repeated for all six ClonelD listed in Table 6. This produced five unique contigs.
  • the contig 253538a contains an open reading frame encoding 432 amino acids. It starts with Gin (CAG) and ends with the stop codon (TGA). The contig 253538a aligns with both M. alpina ⁇ 5 and ⁇ 6 sequences, suggesting that it could be either of the desaturases, as well as other known desaturases which share homology with each other.
  • the individual contigs listed in Table 6, as well as the intermediate contig 2535 and the final contig 253538a can be utilized to isolate the complete genes for human desaturases.
  • human sequences can be expressed in yeast and plants utilizing the procedures described in the preceding examples. For expression in mammalian cells and transgenic animals, these genes may provide superior codon bias. These human sequences can also be used to identify related desaturase sequences.
  • sequences presented in the Sequence Listing including sequences that are homologous to these sequences as well as those sequences that are related to these sequences may be cloned into an appropriate vector using procedures described herein and detailed in the previous examples.
  • host cells can be utilized for the production of lipids and/or fats.
  • the mixture is thoroughly mixed and then transferred to a separating funnel.
  • the mixed material is allowed to settle and two phases are separated out on standing.
  • the bottom phase is collected and the solvent removed under vacuum.
  • the residue contains the total tissue lipids.
  • vectors will be transformed into yeast strains rich in lipids.
  • a high percentage of the cell lipids is often stored in fat droplets containing mostly the triglycerides.
  • simply breaking the cell wall by mechanical, pressure or enzymatic means will release the fat droplet. Once released, the fat is extracted with hexane for further processing.
  • Degumming Degumming is utilized to remove phosphatides co-extracted with the oil, which tend to separate from the oil as a sludge during storage. Two steps are utilized: (1) phosphatides are precipitated with water and then (2) with a mild acid. The particles are removed by centrifugation. 2. Alkali Refining: This step is to utilized to further reduce the phosphatide content and also the free fatty acid content of the oil. In this step, the oil is first contacted with small volume of concentrated phosphoric acid in a mixer to precipitate phosphatides. The acidified mixture is then contacted with an aqueous solution of sodium hydroxide to neutralize the free fatty acids as well as any excess phosphoric acid to form a soapy phase. The soap is removed by centrifugation.
  • Adsorptive Bleaching After the alkali-refining step, the crude oil often contains traces of soap and chlorophylloid compounds. The later gives an undesirable green color to the oil and should be removed. An acid-catalyzed clay or active carbon is utilized to remove these compounds.
  • Deodorization The final refining step is deodorization. Deodorization is utilized to remove compounds from the oil that impart undesirable odors and tastes typical of the host organism. The step involves steam distillation of the odor and flavor compounds and other volatile compounds such as free fatty acids from the oil. The oil is heated to 225-260°C under very low pressure to exclude air and the volatile componds are removed. Deodorization can remove tocopherols to some extent. As the transgenic oil is more unsaturated than non-transgenic oil, additional amount of antioxidant(s) may be supplemented to protect the oil from oxidation.
  • Fractionation Oils are mixtures of tri glycerides with different fatty acid compositions. Based on their different melting points, the triglycerides may be separated into different portions. Thermo-mechanical separation processes include distillation and crystallization. Distillation is generally commercially unsuitable, because the triglyceride mixtures have low vapor pressures and are unstable at high temperature. Crystallization (winterization) uses low temperature to separate solid triglyceride fraction from the liquid fraction. The liquid fraction is usually more unsaturated than the solid fraction. This method is a mild procedure especially suitable for triglyceride containing the polyunsaturated fatty acids.
  • HPLC separation HPLC using a reverse phase column can separate triglyceride molecules according to combined chain length of the fatty acid residues as well as the degree of unsaturation. Using this method, the highly unsaturated triglyceride molecules are eluted out the column for separation.
  • SFC supercritical fluid chromatography
  • SFC supercritical fluid extraction
  • transgenic oil is inco ⁇ orated into various food products.
  • the inco ⁇ oration of transgenic oil into food products involves the following steps: (1) Preparation of slurry mix; (2) blending and (3) standardization:
  • PEF Protein-in-fat slurry
  • Blending Weigh the indicated amount of PLF slurry and add to the PIW slurry, and mix under moderate agitation for 5 min. Add the CHO/MLN to the blend, and adjust to the designated pH value with IN KOH. Thereafter, deaerate the mix by vacuum, heat the mixture to 160-180°F, and emulsify mix at 900-1100 psig in a homogenizer. The mix goes through the UHT treatment, homogenized and pass the mix through a holding tube, and then cool mix to 34-45°F and store until standardization.
  • the PUFAs of the previous examples can be utilized in various nutritional supplements, infant formulations, nutritional substitutes and other nutrition solutions.
  • INFANT FORMULATIONS INFANT FORMULATIONS
  • Lactose-free formulation to avoid lactose-associated diarrhea • Low osmolaity (240 mOsm/kg water) to reduce risk of osmotic diarrhea.
  • Lactose-free formulation to avoid lactose-associated diarrhea (carbohydrate source is Polycose® Glucose Polymers). • Sucrose free for the patient who cannot tolerate sucrose.
  • Fat from a blend of vegetable oils (doubly homogenized), providing essential linoleic acid that is easily absorbed.
  • Ingredients Water, nonfat milk, lactose, soy oil, coconut oil, mono- and diglycerides, soy lecithin, abscorbic acid, carrageenan, choline chloride, taurine, m-inositol, alpha-tocopheryl acetate, zinc sulfate, niacinamid, ferrous sulfate, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, phylloquinone, biotin, sodium selenite, vitamin D 3 and cyanocobalamin .
  • Similac NeoCare is a nutritionally complete formula developed to provide premature infants with extra calories, protein, vitamins and minerals needed to promote catch-up growth and support development.
  • Ingredients Corn syrup solids, nonfat milk, lactose, whey protein concentrate, soy oil, high-oleic safflower oil, fractionated coconut oil (medium- chain triglycerides), coconut oil, potassium citrate, calcium phosphate tribasic, calcium carbonate, ascorbic acid, magnesium chloride, potassium chloride, sodium chloride, taurine, ferrous sulfate, m-inositol, choline chloride, ascorbyl palmitate, L-carnitine, alpha-tocopheryl acetate, zinc sulfate, niacinamide, mixed tocopherols, sodium citrate, calcium pantothenate, cupric sulfate, thiamine chloride hydrochloride, vitamin A palmitate, beta carotene, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, phylloquinone, biot
  • ENSURE is a low-residue liquid food designed primarily as an oral nutritional supplement to be used with or between meals or, in appropriate amounts, as a meal replacement.
  • ENSURE is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets. Although it is primarily an oral supplement, it can be fed by tube.
  • Chloride Magnesium Phosphate Dibasic, Artificial Flavor, Sodium Chloride, Soy Lecithin, Choline Chloride, Ascorbic Acid, Carrageenan, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Gellan Gum, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Folic Acid,
  • ENSURE® BARS Usage ENSURE BARS are complete, balanced nutrition for supplemental use between or with meals. They provide a delicious, nutrient-rich alternative to other snacks. ENSURE BARS contain ⁇ 1 g lactose/bar, and Chocolate Fudge Brownie flavor is gluten-free. (Honey Graham Crunch flavor contains gluten.)
  • Orthophosphate Alpha-Tocopheryl Acetate, Niacinamide, Zinc Oxide, Calcium Pantothenate, Copper Gluconate, Manganese Sulfate, Riboflavin, Beta-Carotene, Pyridoxine Hydrochloride, Thiamine Mononitrate, Folic Acid, Biotin, Chromium Chloride, Potassium Iodide, Sodium Selenate, Sodium Molybdate, Phylloquinone, Vitamin D 3 and Cyanocobalamin.
  • Honey Graham Crunch - The protein source is a blend of soy protein isolate and milk proteins.
  • the fat source is a blend of partially hydrogenated cottonseed and soybean, canola, high oleic safflower, and corn oils, and soy lecithin.
  • Partially hydrogenated cottonseed and soybean oil 76%
  • Soy lecithin 4% Carbohydrate Soy lecithin 4% Carbohydrate:
  • the carbohydrate source is a combination of high- fructose corn syrup, brown sugar, maltodextrin, honey, crisp rice, glycerine, soy polysaccharide, and oat bran.
  • ENSURE HIGH PROTEIN is a concentrated, high-protein liquid food designed for people who require additional calories, protein, vitamins, and minerals in their diets. It can be used as an oral nutritional supplement with or between meals or, in appropriate amounts, as a meal replacement.
  • ENSURE HIGH PROTEIN is lactose- and gluten-free, and is suitable for use by people recovering from general surgery or hip fractures and by patients at risk for pressure ulcers.
  • vanilla Supreme Water, Sugar (Sucrose), Maltodextrin (Corn), Calcium and Sodium Caseinates, High-Oleic Safflower Oil, Soy Protein Isolate, Soy Oil, Canola Oil, Potassium Citrate, Calcium Phosphate Tribasic, Sodium Citrate, Magnesium Chloride, Magnesium Phosphate Dibasic, Artificial Flavor, Sodium Chloride, Soy
  • Lecithin Choline Chloride, Ascorbic Acid, Carrageenan, Zinc Sulfate, Ferrous Suffate, Alpha-Tocopheryl Acetate, Gellan Gum, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Folio Acid, Sodium Motybdate, Chromium Chloride, Biotin, Potassium Iodide, Sodium
  • the protein source is a blend of two high-biologic-value proteins: casein and soy.
  • the fat source is a blend of three oils: high-oleic safflower, canola, and soy.
  • the level of fat in ENSURE HIGH PROTEIN meets American Heart Association (AHA) guidelines.
  • AHA American Heart Association
  • the 6 grams of fat in ENSURE HIGH PROTEIN represent 24% of the total calories, with 2.6% of the fat being from saturated fatty acids and 7.9% from polyunsaturated fatty acids. These values are within the AHA guidelines of ⁇ 30% of total calories from fat, ⁇ 1 0% of the calories from saturated fatty acids, and ⁇ 1 0% of total calories from polyunsaturated fatty acids.
  • ENSURE HIGH PROTEIN contains a combination of maltodextrin and sucrose.
  • the mild sweetness and flavor variety vanilla supreme, chocolate royal, wild berry, and banana
  • ENSURE LIGHT is a low-fat liquid food designed for use as an oral nutritional supplement with or between meals.
  • ENSURE LIGHT is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets.
  • the protein source is calcium caseinate.
  • the fat source is a blend of two oils: high-oleic safflower and canola.
  • the level of fat in ENSURE LIGHT meets American Heart Association (AHA) guidelines.
  • AHA American Heart Association
  • the 3 grams of fat in ENSURE LIGHT represent 13.5% of the total calories, with 1.4% of the fat being from saturated fatty acids and 2.6% from polyunsaturated fatty acids. These values are within the AHA guidelines of ⁇ 30% of total calories from fat, ⁇ 1 0% of the calories from saturated fatty acids, and ⁇ 1 0% of total calories from polyunsaturated fatty acids.
  • ENSURE LIGHT contains a combination of maltodextrin and sucrose.
  • the chocolate flavor contains corn syrup as well.
  • the mild sweetness and flavor variety (French vanilla, chocolate supreme, strawberry swirl), plus VARI- FLAVORS® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, help to prevent flavor fatigue and aid in patient compliance.
  • An 8-fl-oz serving of ENSURE LIGHT provides at least 25% of the RDIs for 24 key vitamins and minerals.
  • Chocolate flavor contains 2.1 mg caffeine/8 fl oz.
  • ENSURE PLUS is a high-calorie, low-residue liquid food for use when extra calories and nutrients, but a normal concentration of protein, are needed. It is designed primarily as an oral nutritional supplement to be used with or between meals or, in appropriate amounts, as a meal replacement. ENSURE PLUS
  • PLUS is lactose- and gluten-free. Although it is primarily an oral nutritional supplement, it can be fed by tube.
  • vanilla Water, Com Syrup, Maltodextrin (Com), Com Oil, Sodium and Calcium
  • Chloride Hydrochloride Pyridoxine Hydrochloride, Riboflavin, Vitamin A Palmitate, Folic Acid, Biotin, Chromium Chloride, Sodium Molybdate, Potassium Iodide, Sodium Selenite, Phylloquinone, Cyanocobalamin and Vitamin D 3 .
  • Protein The protein source is a blend of two high-biologic-value proteins: casein and soy.
  • Fat The fat source is co oil.
  • ENSURE PLUS contains a combination of maltodextrin and sucrose.
  • the mild sweetness and flavor variety vanilla, chocolate, strawberry, coffee, buffer pecan, and eggnog
  • An 8-fl-oz serving of ENSURE PLUS provides at least 15% of the RDIs for 25 key Vitamins and minerals.
  • Chocolate flavor contains 3.1 mg Caffeine/8 fl oz. Coffee flavor contains a trace amount of caffeine.
  • ENSURE PLUS HN is a nutritionally complete high-calorie, high- nitrogen liquid food designed for people with higher calorie and protein needs or limited volume tolerance. It may be used for oral supplementation or for total nutritional support by tube. ENSURE PLUS HN is lactose- and gluten-free. Patient Conditions:
  • ENSURE POWDER (reconstituted with water) is a low-residue liquid food designed primarily as an oral nutritional supplement to be used with or between meals.
  • ENSURE POWDER is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets.
  • Protein The protein source is a blend of two high-biologic-value proteins: casein and soy.
  • Fat The fat source is com oil.
  • ENSURE POWDER contains a combination of com syrup, maltodextrin, and sucrose.
  • ENSURE PUDDING is a nutrient-dense supplement providing balanced nutrition in a nonliquid form to be used with or between meals. It is appropriate for consistency-modified diets (e.g., soft, pureed, or full liquid) or for people with swallowing impairments.
  • ENSURE PUDDING is gluten-free.
  • Protein The protein source is nonfat milk. Nonfat milk 100%
  • the fat source is hydrogenated soybean oil.
  • ENSURE PUDDING contains a combination of sucrose and modified food starch.
  • the mild sweetness and flavor variety vanilla, chocolate, butterscotch, and tapioca) help prevent flavor fatigue.
  • the product contains 9.2 grams of lactose per serving.
  • ENSURE WITH FIBER is a fiber-containing, nutritionally complete liquid food designed for people who can benefit from increased dietary fiber and nutrients.
  • ENSURE WITH FIBER is suitable for people who do not require a low-residue diet. It can be fed orally or by tube, and can be used as a nutritional supplement to a regular diet or, in appropriate amounts, as a meal replacement.
  • ENSURE WITH FIBER is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets.
  • vanilla Water, Maltodextrin (Corn), Sugar (Sucrose), Sodium and Calcium Caseinates, Oat Fiber, High-Oleic Safflower Oil, Canola Oil, Soy Protein Isolate, Com Oil, Soy Fiber, Calcium Phosphate Tribasic, Magnesium Chloride, Potassium Citrate, Cellulose Gel, Soy Lecithin, Potassium Phosphate Dibasic, Sodium
  • the protein source is a blend of two high-biologic-value proteins- casein and soy.
  • the fat source is a blend of three oils: high-oleic safflower, canola, and com.
  • the level of fat in ENSURE WITH FIBER meets American Heart Association (AHA) guidelines.
  • AHA American Heart Association
  • the 6 grams of fat in ENSURE WITH FIBER represent 22% of the total calories, with 2.01 % of the fat being from saturated fatty acids and 6.7% from polyunsaturated fatty acids.
  • ENSURE WITH FIBER contains a combination of maltodextrin and sucrose.
  • the mild sweetness and flavor variety vanilla, chocolate, and butter pecan
  • the fiber blend used in ENSURE WITH FIBER consists of oat fiber and soy polysaccharide. This blend results in approximately 4 grams of total dietary fiber per 8-fl-oz can. The ratio of insoluble to soluble fiber is 95:5.
  • the various nutritional supplements described above and known to others of skill in the art can be substituted and/or supplemented with the PUFAs of this invention.
  • Oxepa is low-carbohydrate, calorically dense enteral nutritional product designed for the dietary management of patients with or at risk for ARDS. It has a unique combination of ingredients, including a patented oil blend containing eicosapentaenoic acid (EPA from fish oil), ⁇ -linolenic acid (GLA from borage oil), and elevated antioxidant levels.
  • EPA eicosapentaenoic acid
  • GLA ⁇ -linolenic acid
  • Caloric Distribution • Caloric density is high at 1.5 Cal/mL (355 Cal/8 fl oz), to minimize the volume required to meet energy needs.
  • Oxepa contains 22.2 g of fat per 8-fl oz serving (93.7 g/L).
  • the fat source is a oil blend of 31.8% canola oil, 25% medium-chain triglycerides (MCTs), 20% borage oil, 20% fish oil, and 3.2 % soy lecithin.
  • MCTs medium-chain triglycerides
  • borage oil 20% borage oil
  • fish oil 3.2 % soy lecithin.
  • the typical fatty acid profile of Oxepa is shown in Table 8.
  • Oxepa provides a balanced amount of polyunsaturated, monounsaturated, and saturated fatty acids, as shown in Table 10.
  • MCTs Medium-chain trigylcerides
  • OxepaTM nutritional product can be substituted and/or supplemented with the PUFAs of this invention.
  • the carbohydrate content is 25.0 g per 8-fl-oz serving (105.5 g/L). • The carbohydrate sources are 45% maltodextrin (a complex carbohydrate) and 55% sucrose (a simple sugar), both of which are readily digested and absorbed.
  • the high-fat and low-carbohydrate content of Oxepa is designed to minimize carbon dioxide (CO ) production.
  • CO 2 levels can complicate weaning in ventilator-dependent patients.
  • the low level of carbohydrate also may be useful for those patients who have developed stress-induced hyperglycemia.
  • Oxepa is lactose-free.
  • Dietary carbohydrate the amino acids from protein, and the glycerol moiety of fats can be converted to glucose within the body. Throughout this process, the carbohydrate requirements of glucose-dependent tissues (such as the central nervous system and red blood cells) are met. However, a diet free of carbohydrates can lead to ketosis, excessive catabolism of tissue protein, and loss of fluid and electrolytes. These effects can be prevented by daily ingestion of 50 to 100 g of digestible carbohydrate, if caloric intake is adequate. The carbohydrate level in Oxepa is also sufficient to minimize gluconeogenesis, if energy needs are being met.
  • Oxepa contains 14.8 g of protein per 8-fl-oz serving (62.5 g/L).
  • the protein sources of Oxepa are 86.8% sodium caseinate and 13.2% calcium caseinate.

Abstract

The present invention relates to a fatty acid Δ5-desaturase able to catalyze the conversion of dihomo-gamma-linolenic acid to arachidonic acid. Nucleic acid sequences encoding a Δ5-desaturase, nucleic acid sequences which hibridize thereto, DNA constructs comprising a Δ5-desaturase gene, recombinant host insect or animal expressing increased levels of a Δ5-desaturase, purified Δ5-desaturase proteins and antibodies (polyclonal and monoclonal) to the purified Δ5-desaturase proteins are described. Methods for desaturating a fatty acid at the Δ5 position and for producing arachidonic acid by expressing increased levels of a Δ5 desaturase are disclosed. Methods of producing transgenic oil in microorganisms are disclosed. Methods of purifying the oils and preparing the oils for food products are also disclosed. Fatty acids, and oils containing them, which have been desaturated by a Δ5-desaturase produced by recombinant host microorganisms or animals are provided. Pharmaceutical compositions, infant formulas or dietary supplements containing fatty acids which have been desaturated by a Δ5-desaturase produced by a recombinant host microorganism or animal also are described.

Description

ALTERED FATTY ACID BIOSYNTHESIS IN INSECT CELLS USING DELTA FIVE DESATURASE
INTRODUCTION
Field of the Invention This invention relates to modulating levels of enzymes and/or enzyme components relating to production of long chain poly-unsaturated fatty acids (PUFAs) and Δ5 desaturases in insects or animals.
Background Two main families of polyunsaturated fatty acids (PUFAs) are the ω3 fatty acids, exemplified by eicosapentaenoic acid (EPA), and the ω6 fatty acids, exemplified by arachidonic acid (ARA). PUFAs are important components of the plasma membrane of the cell, where they may be found in such forms as phospholipids. PUFAs are necessary for proper development, particularly in the developing infant brain, and for tissue formation and repair. PUFAs also serve as precursors to other molecules of importance in human beings and animals, including the prostacyclins, eicosanoids, leukotrienes and prostaglandins.
Four major long chain PUFAs of importance include docosahexaenoic acid (DHA) and EPA, which are primarily found in different types of fish oil, gamma-linolenic acid (GLA), which is found in the seeds of a number of plants, including evening primrose (Oenothera biennis), borage (Borago officinalis) and black currants (Ribes nigrum), and stearidonic acid (SDA), which is found in marine oils and plant seeds. Both GLA and another important long chain PUFA, arachidonic acid (ARA), are found in filamentous fungi. ARA can be purified from animal tissues including liver and adrenal gland. GLA, ARA,
EPA and SDA are themselves, or are dietary precursors to, important long chain fatty acids involved in prostaglandin synthesis, in treatment of heart disease, and in development of brain tissue. Polyunsaturated fatty acids have a number of pharmaceutical and medical applications including treatment of heart disease, cancer and arthritis.
For DHA, a number of sources exist for commercial production including a variety of marine organisms, oils obtained from cold water marine fish, and egg yolk fractions. For ARA, microorganisms including the genera Mortierella, Entomophthora, Phytium and Porphyridium can be used for commercial production. Commercial sources of SDA include the genera Trichodesma and Echium. Commercial sources of GLA include evening primrose, black currants and borage. However, there are several disadvantages associated with commercial production of PUFAs from natural sources. Natural sources of PUFAs, such as animals and plants, tend to have highly heterogeneous oil compositions. The oils obtained from these sources therefore can require extensive purification to separate out one or more desired PUFAs or to produce an oil which is enriched in one or more PUFA. Natural sources also are subject to uncontrollable fluctuations in availability. Fish stocks may undergo natural variation or may be depleted by overfishing. Fish oils have unpleasant tastes and odors, which may be impossible to economically separate from the desired product, and can render such products unacceptable as food supplements. Animal oils, and particularly fish oils, can accumulate environmental pollutants. Weather and disease can cause fluctuation in yields from both fish and plant sources. Cropland available for production of alternate oil-producing crops is subject to competition from the steady expansion of human populations and the associated increased need for food production on the remaining arable land. Crops which do produce PUFAs, such as borage, have not been adapted to commercial growth and may not perform well in monoculture. Growth of such crops is thus not economically competitive where more profitable and better established crops can be grown. Large scale fermentation of organisms such as Mortierella is also expensive. Natural animal tissues contain low amounts of ARA and are difficult to process. Microorganisms such as Porphyridium and Mortierella are difficult to cultivate on a commercial scale. Dietary supplements and pharmaceutical formulations containing PUFAs can retain the disadvantages of the PUFA source. Supplements such as fish oil capsules can contain low levels of the particular desired component and thus require large dosages. High dosages result in ingestion of high levels of undesired components, including contaminants. Unpleasant tastes and odors of the supplements can make such regimens undesirable, and may inhibit compliance by the patient. Care must be taken in providing fatty acid supplements, as overaddition may result in suppression of endogenous biosynthetic pathways and lead to competition with other necessary fatty acids in various lipid fractions in vivo, leading to undesirable results. For example, Eskimos having a diet high in co3 fatty acids have an increased tendency to bleed (U.S. Pat. No. 4,874,603).
A number of enzymes are involved in PUFA biosynthesis. Linolenic acid (LA, 18:2 Δ9, 12) is produced from oleic acid (18:1 Δ9) by a Δ12- desaturase. GLA (18:3 Δ6, 9, 12) is produced from linoleic acid (LA, 18:2 Δ9, 12) by a Δ6-desaturase. ARA (20:4 Δ5, 8, 11, 14) production from dihomo- gamma-linolenic acid (DGLA, 20:3 Δ8, 11, 14) is catalyzed by a Δ5-desaturase. However, animals cannot desaturate beyond the Δ9 position and' therefore cannot convert oleic acid (18:1 Δ9) into linolenic acid (18:2 Δ912). Likewise, α-linoleic acid (ALA, 18:3 Δ9, 12, 15) cannot be synthesized by mammals.
Other eukaryotes, including fungi and plants, have enzymes which desaturate at positions Δ12 and Δ15. The major poly-unsaturated fatty acids of animals therefore are either derived from diet and/or from desaturation and elongation of linoleic acid (18:2 Δ9, 12) or o -linolenic acid (18:3 Δ9, 12, 15). Therefore it is of interest to obtain genetic material involved in PUFA biosynthesis from species that naturally produce these fatty acids and to express the isolated material in a microbial or animal system which can be manipulated to provide production of commercial quantities of one or more PUFAs. Thus there is a need for fatty acid desaturases, genes encoding them, and recombinant methods of producing them. A need further exists for oils containing higher relative proportions of and/or enriched in specific PUFAs. A need also exists for reliable economical methods of producing specific PUFAs.
In particular, there is a need to express PUFAs in a baculovirus expression system using cultured insect cells such as Spodoptera frugiperda (Sf9), army fallworm. The lipid composition of Sf9 cells has been well characterized and are known to contain low proportions of polyunsaturated fatty acids. As such, production of PUFAs in insect cells would provide a good source of purified Δ5 desaturases for use in enzyme studies and antibody production as well as a good source of PUFAs for use in various oils, nutritional supplements, cosmetic agents and the like.
Summary of the Invention
Novel compositions and methods are provided for preparation of polyunsaturated long chain fatty acids or PUFAs. The compositions include nucleic acids encoding a Δ5-desaturase and/or polypeptides having Δ5-desaturase activity, the polypeptides, and probes for isolating and detecting the same. The methods involve growing a host microorganism or animal which contains and expresses one or more transgenes encoding a Δ5-desaturase and/or a polypeptide having Δ5-desaturase activity. Expression of the desaturase polypeptide provides for a relative increase in Δ5-desaturated PUFA, or metabolic progeny therefrom, as a result of altered concentrations of enzymes and substrates involved in PUFA biosynthesis. The invention finds use for example in the large scale production of PUFA containing oils which include, for example, ARA, EPA and/or DHA.
The invention is also directed to methods of producing purified Δ5 desaturase in an insect cell culture system. The purified protein can be used as an antigen for the production of polyclonal and monoclonal antibodies. These antibodies find use in methods of purifying the Δ5 desaturases and in methods of detecting levels of Δ5 desaturase polypeptide in complex solutions. The purified Δ5 desaturase protein also finds use in studies of the Δ5 desaturase enzyme including X-ray crystal structures for structure-function studies. Once the purified protein has been studied in some detail, the enzyme can be modified by genetic engineering techniques to improve enzymatic activity and to alter substrate specificities.
In a preferred embodiment, a nucleic acid sequence comprising a Δ5- desaturase depicted in Figure 3A-D (SEQ ID NO 1), a polypeptide encoded by the nucleic acid, and a purified or isolated polypeptide depicted in Figure 3A-D (SEQ ID NO: 2), and an isolated nucleic acid encoding the polypeptide of Figure 3A-D (SEQ ID NO: 2) are provided. Another embodiment of the invention is an isolated nucleic acid sequence which encodes a polypeptide, wherein said polypeptide desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the molecule. The nucleic acid is preferably derived from a eukaryotic cell, such as a fungal cell, or a fungal cell of the genus Mortierella, or of the genus/species Mortierella alpina. Also preferred is an isolated nucleic acid comprising a sequence which anneals to a nucleotide sequence depicted in Figure 3A-3D (SEQ ID NO: 1), and a nucleic acid which encodes an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2). In particular, the nucleic acid encodes an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2) which is selected from the group consisting of amino acid residues 30-38, 41- 44, 171-175, 203-212, and 387-394. In an additional embodiment, the invention provides an isolated or purified polypeptide which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the molecule. Also provided is an isolated nucleic acid sequence which hybridizes to a nucleotide sequence depicted in Figure 3A-D (SEQ ID NO 1), an isolated nucleic acid sequence having at least about 50% identity to Figure 3A-D (SEQ ID NO 1).
The present invention further includes a nucleic acid construct comprising a nucleotide sequence depicted in a Figure 3A-D (SEQ ID NO: 1) linked to a heterologous nucleic acid; a nucleic acid construct comprising a nucleotide sequence depicted in a Figure 3A-D (SEQ ID NO: 1) operably linked to a promoter; and a nucleic acid construct comprising a nucleotide sequence -o-
depicted in a Figure 3A-D (SEQ ID NO: 1) operably linked to a promoter which is functional in a microbial cell. In a preferred embodiment, the microbial cell is a yeast cell, and the nucleotide sequence is derived from a fungus, such as a fungus of the genus Mortierella, particularly a fungus of the species Mortierella alpina.
In another embodiment of the invention, a nucleic acid construct is provided which comprises a nucleotide sequence which encodes a polypeptide comprising an amino acid sequence which corresponds to or is complementary to an amino acid sequence depicted in Figure 3A-D (SEQ ID NO: 2), wherein the nucleotide sequence is operably linked to a promoter which is functional in a host cell, and wherein the nucleotide sequence encodes a polypeptide which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of a fatty acid molecule. Additionally, provided by the invention is a nucleic acid construct comprising a nucleotide sequence which encodes a functionally active Δ5-desaturase, where the desaturase includes an amino acid sequence which corresponds to or is complementary to all of or a portion of an amino acid sequence depicted in a Figure 3A-D (SEQ ID NO: 2), wherein the nucleotide sequence is operably linked to a promoter functional in a host cell.
The invention also includes a host cell comprising a nucleic acid construct of the invention. In a preferred embodiment, a recombinant host cell is provided which comprises at least one copy of a DNA sequence which encodes a functionally active Mortierella alpina fatty acid desaturase having an amino acid sequence as depicted in Figure 3A-D (SEQ ID NO: 2), wherein the cell or an ancestor of the cell was transformed with a vector comprising said DNA sequence, and wherein the DNA sequence is operably linked to a promoter. The host cell is either eukaryotic or prokaryotic. Preferred eukaryotic host cells are those selected from the group consisting of a mammalian cell, an insect cell, a fungal cell, and an algae cell. A preferred algae is a marine algae. Most preferred is an insect cell. Most preferred insect cells include fall army worm cells, Spodoptera frugiperda (Sf9 and Sf21 cells) and cabbage lopper moth, Trichoplusia ni (Hi Five Cells). Preferred prokaryotic cells include those selected from the group consisting of a bacteria, a cyanobacteria, cells which contain a bacteriophage, and/or a virus. The DNA sequence of the recombinant host cell preferably contains a promoter which is functional in the host cell. The host cells of the invention which contain the DNA sequences of the invention are enriched for fatty acids, such as 20:3 fatty acids. In a preferred embodiment, the host cells are enriched for 20:4 fatty acids as compared to an un transformed host cell which is devoid of said DNA sequence, and/or enriched for 20:5 fatty acids compared to an untransformed host cell which is devoid of said DNA sequence. In yet another preferred embodiment, the invention provides a recombinant host cell which comprises a fatty acid selected from the group consisting of a dihomo-γ-linolenic acid, n-6 eicosatrienoic acid, 20:3n-6 acid and 20:3 (8,11,14) acid.
The present invention also includes method for production of arachidonic acid in a insect cell culture, where the method comprises growing an insect cell culture having a plurality of insect cells which contain one or more nucleic acids encoding a polypeptide which converts dihomo-γ-linolenic acid to arachidonic acid, wherein the nucleic acid is operably linked to a promoter, under conditions whereby said one or more nucleic acids are expressed, whereby arachidonic acid is produced in the microbial cell culture. In several preferred embodiments of the invention, the polypeptide is an enzyme which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of the fatty acid molecule; the nucleic acid is derived from a Mortierella sp.; and the substrate for said polypeptide is exogenously supplied. Preferred insect cells include spodoptera frugipera (Sf9 and Sf 21). Preferred mammalian cells include an avian cell, a preferred fungal cell is a yeast, and the preferred algae cell is a marine algae cell. The preferred prokaryotic cells include those selected from the group consisting of a bacteria, a cyanobacteria, cells which contain a bacteriophage, and/or a virus. The nucleic acid sequence encoding the polypeptide of the microbial cell preferably contains a promoter which is functional in the host cell which optionally is an inducible promoter for example by components of the culture broth. The preferred microbial cells used in the methods are yeast cells, such as Saccharomyces cells.
In another embodiment of the invention, a recombinant yeast cell is provided which converts greater than about 5% of 20:3 fatty acid substrate to a 20:4 fatty acid product.
Also provided is an oil comprising one or more PUFA. The amount of said one or more PUFAs is approximately 0.3-30% arachidonic acid (ARA), approximately 0.2-30% dihomo-γ-linolenic acid (DGLA), and approximately 0.2-30% γ-linolenic acid (GLA). A preferred oil of the invention is one in which the ratio of ARA:DGLA:GLA is approximately 1.0: 19.0:30 to
6.0: 1.0:0.2. Another preferred embodiment of the invention is a pharmaceutical composition comprising the oils in a pharmaceutically acceptable carrier. Further provided is a nutritional composition comprising the oils of the invention. The nutritional compositions of the invention preferably are administered to a mammalian host parenterally or internally. A preferred composition of the invention for internal consumption is an infant formula. In a preferred embodiment, the nutritional compositions of the invention are in a liquid form or a solid form.
The present invention also includes a method for desaturating a fatty acid, where the method comprises culturing a recombinant microbial cell of the invention under conditions suitable for expression of a polypeptide encoded by the nucleic acid, wherein the host cell further comprises a fatty acid substrate of the polypeptide. In a preferred embodiment, a fatty acid desaturated by the methods is provided, including an oil comprising the fatty acid. The present invention is also directed to purified nucleotide and peptide sequences presented in SEQ ID NO: 1-34. The present invention is further directed toward methods of using the sequences presented in SEQ ID NO: 1-34 as probes to identify related sequences, as components of expression systems and as components of systems useful for producing transgenic oil. The present invention is further directed to methods of obtaining altered long chain poly unsaturated fatty acid biosystems by growing transgenic microbes which encode transgene expression products which desaturate a fatty acid molecule at carbon 5 from the carboxyl end of the fatty acid molecule. The present invention is further directed to formulas, dietary supplements or dietary substitutes in the form of a liquid or a solid containing the long chain fatty acids of the invention. These formulas, supplements and substitutes may be administered to a human or an animal.
The formulas, supplements of the invention may further comprise at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
The formulas of the present invention may further include at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphorus, copper, chloride, iodine, selenium, and iron.
The present invention is further directed to a method of treating a patient having a condition caused by insufficient intake or production of polyunsaturated fatty acids comprising administering to the patient a dietary substitute of the invention in an amount sufficient to effect treatment of the patient.
The present invention is further directed to cosmetic and pharmaceutical compositions of the material of the invention.
The present invention is also directed to an isolated nucleotide sequence comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO:13; SEQ ID NO:15; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO:21; SEQ ID NO:22; SEQ ID NO:22; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26 and SEQ ID NO:27. The present invention is also directed to an isolated peptide sequence comprising a peptide sequence selected from the group consisting of: SEQ ID NO: 14; SEQ LD NO: 16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:28; SEQ ID O:29; SEQ ID NO:30; SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:33 and SEQ ID NO:34.
The present invention is further directed to transgenic oils in pharmaceutically acceptable carriers. The present invention is further directed to nutritional supplements, cosmetic agents and infant formulae containing transgenic oils. The present invention is further directed to a method for obtaining altered long chain polyunsaturated fatty acid biosynthesis comprising the steps of: growing a microbe having cells which contain a transgene which encodes a transgene expression product which desaturates a fatty acid molecule at carbon 5 from the carboxyl end of said fatty acid molecule, wherein the transgene is operably associated with an expression control sequence, under conditions whereby the transgene is expressed, whereby long chain polyunsaturated fatty acid biosynthesis in the cells is altered.
The present invention is further directed to the use of chain polyunsaturated fatty acid selected from the group consisting of ARA, DGLA and EPA.
The present invention is further directed toward pharmaceutical compositions comprising at least one nutrient selected from the group consisting of a vitamin, a mineral, a carbohydrate, a sugar, an amino acid, a free fatty acid, a phospholipid, an antioxidant, and a phenolic compound. Brief Description of the Drawings
Figure 1 shows possible pathways for the synthesis of arachidonic acid (20:4 Δ5, 8, 11, 14) and stearidonic acid (18:4 Δ6, 9, 12, 15) from palmitic acid (Cι6) from a variety of organisms, including algae, Mortierella and humans. These PUFAs can serve as precursors to other molecules important for humans and other animals, including prostacyclins, leukotrienes, and prostaglandins, some of which are shown.
Figure 2 shows possible pathways for production of PUFAs in addition to ARA, including EPA and DHA, for a variety of organisms. Figure 3A-D shows the DNA sequence of the Mortierella alpina Δ5- desaturase and the deduced amino acid sequence.
Figure 4 shows the deduced amino acid sequence of the PCR fragment (see Example 1)
Figure 5A and 5B show alignments of the protein sequence of the Δ5- desaturase with Δ6-desaturases.
Figure 6A and 6B show the effect of the timing of substrate addition relative to induction on conversion of substrate to product in SC334 containing the Δ5-desaturase gene.
Figure 7A and 7B show the effect of inducer concentration on Δ5- desaturase expression in SC334.
Figure 8A and 8B show the effect of induction temperature on Δ5- desaturase activity in SC334.
Figure 9A and 9B show the effect of host strain on the conversion of substrate to product in strains expressing the Δ5-desaturase gene at 15°C. Figure 10A and 10B show the effect of host strain on the conversion of substrate to product in strains expressing the Δ5-desaturase gene at 30°C. Figure 11 shows the effect of a host strain expressing choline transferase as well as the Δ5-desaturase gene on the conversion of substrate to product.
Figure 12A and 12B show the effect of media composition and temperature on the conversion of substrate to product in two host strains expressing the Δ5-desaturase gene.
Figure 13 shows alignment of the protein sequence of Ma 29 and contig 253538a.
Figure 14 shows alignment of the protein sequence of Ma 524 and contig 253538a.
Brief Description of the Sequence Listings
SEQ ID NO: 1 shows a DNA sequence of the Mortierella alpina Δ5- desaturase.
SEQ ID NO:2 shows an amino acid sequence of Mortierella alpina Δ5- desaturase.
SEQ ID NO: 3 shows the deduced amino acid sequence of the M. alpina PCR fragment (see Example 1).
SEQ LD NO: 4 - SEQ ID NO: 7 show the deduced amino acid sequences of various Δ6-desaturases. SEQ ID NO: 8 and SEQ ID NO: 9 show PCR primer sequences for Δ6- desaturases
SEQ LD NO: 10 shows a primer for reverse transcription of total RNA.
SEQ LD NO: 11 and SEQ ID NO: 12 show amino acid motifs for desaturase sequences. SEQ LD NO: 13 and SEQ ID NO: 14 show the nucleotide and amino acid sequence of a Dictyostelium discoideum desaturase sequence. SEQ LD NO: 15 and SEQ ID NO: 16 show the nucleotide and amino acid sequence of a Phaeodactylum tricornutum desaturase sequence.
SEQ JD NO: 17-20 show the nucleotide and deduced amino acid sequence of a Schizochytrium cDNA clone.
SEQ JD NO: 21-27 show nucleotide sequences for human desaturases.
SEQ LD NO: 28 - SEQ ID NO: 34 show peptide sequences for human desaturases.
Detailed Description of the Invention
In order to ensure a complete understanding of the invention, the following definitions are provided:
Δ5-Desaturase: Δ5 desaturase is an enzyme which introduces a double bond between carbons 5 and 6 from the carboxyl end of a fatty acid molecule.
Δ6-Desaturase: Δ6-desaturase is an enzyme which introduces a double bond between carbons 6 and 7 from the carboxyl end of a fatty acid molecule.
Δ9-Desaturase: Δ9-desaturase is an enzyme which introduces a double bond between carbons 9 and 10 from the carboxyl end of a fatty acid molecule.
Δl2-Desaturase: Δl2-desaturase is an enzyme which introduces a double bond between carbons 12 and 13 from the carboxyl end of a fatty acid molecule.
Fatty Acids: Fatty acids are a class of compounds containing a long hydrocarbon chain and a terminal carboxylate group. Fatty acids include the following:
Figure imgf000015_0001
Figure imgf000016_0001
Taking into account these definitions, the present invention is directed to novel DNA sequences, DNA constructs, methods and compositions are provided which permit modification of the poly-unsaturated long chain fatty acid content of, for example, microbial cells or animals. Host cells are manipulated to express a sense or antisense transcript of a DNA encoding a polypeptide(s) which catalyzes the conversion of DGLA to ARA. The substrate(s) for the expressed enzyme may be produced by the host cell or may be exogenously supplied. To achieve expression, the transformed DNA is operably associated with transcriptional and translational initiation and termination regulatory regions that are functional in the host cell. Constructs comprising the gene to be expressed can provide for integration into the genome of the host cell or can autonomously replicate in the host cell. For production of ARA, the expression cassettes generally used include a cassette which provides for Δ5-desaturase activity, particularly in a host cell which produces or can take up DGLA. Production of ω6-type unsaturated fatty acids, such as ARA, is favored in a host microorganism or animal which is substantially free of ALA. The host is selected or obtained by removing or inhibiting activity of a Δ15 desaturase or a desaturase involved in the omega-3 pathway (see Figure 2). The endogenous desaturase activity can be affected by providing an expression cassette for an antisense Δ15 or ω3 transcript, by disrupting a target Δ15- or cc>3- desaturase gene through insertion, substitution and/or deletion of all or part of the target gene, or by adding a Δ15- or ω3 -desaturase inhibitor. Production of LA also can be increased by providing expression cassettes for Δ9 and/or Δ12- desaturases where their respective enzymatic activities are limiting.
INSECT CELL PRODUCTION OF FATTY ACIDS
Insect cell production of fatty acids has several advantages over purification from natural sources such as fish or plants. Many insect cells are known with greatly simplified lipid compositions compared with those of higher organisms, making purification of desired components easier. Insect cell fatty acid production is not subject to fluctuations caused by external variables such as weather and food supply. Insect cell produced fatty acids are substantially free of contamination by environmental pollutants. Additionally, insect cells can provide PUFAs in particular forms which may have specific uses. Additionally, insect cell lipid production can be manipulated by controlling culture conditions, notably by providing particular substrates for microbially expressed enzymes, or by addition of compounds which suppress undesired biochemical pathways. In addition to these advantages, production of fatty acids from recombinant microbes provides the ability to alter the naturally occurring microbial fatty acid profile by providing new synthetic pathways in the host or by suppressing undesired pathways, thereby increasing levels of desired PUFAs, or conjugated forms thereof, and decreasing levels of undesired PUFAs.
PRODUCTION OF FATTY ACIDS IN ANIMALS
Production of fatty acids in animals also presents several advantages. Expression of desaturase genes in animals can produce greatly increased levels of desired PUFAs in animal tissues, making recovery from those tissues more economical. For example, where the desired PUFAs are expressed in the breast milk of animals, methods of isolating PUFAs from animal milk are well established. In addition to providing a source for purification of desired PUFAs, animal breast milk can be manipulated through expression of desaturase genes, either alone or in combination with other human genes, to provide animal milks with a PUFA composition substantially similar to human breast milk during the different stages of infant development. Humanized animal milks could serve as infant formulas where human nursing is impossible or undesired, or in cases of malnourishment or disease.
Depending upon the host cell, the availability of substrate, and the desired end product(s), several polypeptides, particularly desaturases, are of interest. By "desaturase" is intended a polypeptide which can desaturate one or more fatty acids to produce a mono- or poly-unsaturated fatty acid or precursor thereof of interest. Of particular interest are polypeptides which can catalyze the conversion of DGLA to produce ARA which includes enzymes which desaturate at the Δ5 position. By "polypeptide" is meant any chain of amino acids, regardless of length or post-translational modification, for example, glycosylation or phosphorylation. Considerations for choosing a specific polypeptide having desaturase activity include the pH optimum of the polypeptide, whether the polypeptide is a rate limiting enzyme or a component thereof, whether the desaturase used is essential for synthesis of a desired polyunsaturated fatty acid, and/or co-factors required by the polypeptide. The expressed polypeptide preferably has parameters compatible with the biochemical environment of its location in the host cell. For example, the polypeptide may have to compete for substrate with other enzymes in the host cell. Analyses of the Km and specific activity of the polypeptide in question therefore are considered in determining the suitability of a given polypeptide for modifying PUFA production in a given host cell. The polypeptide used in a particular situation is one which can function under the conditions present in the intended host cell but otherwise can be any polypeptide having desaturase activity which has the desired characteristic of being capable of modifying the relative production of a desired PUFA.
For production of ARA, the DNA sequence used encodes a polypeptide having Δ5-desaturase activity. In particular instances, this can be coupled with an expression cassette which provides for production of a polypeptide having Δ6-desaturase activity and the host cell can optionally be depleted of any Δ15- desaturase activity present, for example by providing a transcription cassette for production of antisense sequences to the Δ15-desaturase transcription product, by disrupting the Δ15-desaturase gene, or by using a host cell which naturally has, or has been mutated to have, low Δ15-desaturase activity. Inhibition of undesired desaturase pathways also can be accomplished through the use of specific desaturase inhibitors such as those described in U.S. Patent No.
4,778,630. The choice of combination of cassettes used can depend in part on the PUFA profile of the host cell. Where the host cell Δ5-desaturase activity is limiting, overexpression of Δ5-desaturase alone generally will be sufficient to provide for enhanced ARA production in the presence of an appropriate substrate such as DGLA. ARA production also can be increased by providing expression cassettes for Δ9- or Δ12-desaturase genes when the activities of those desaturases are limiting. A scheme for the synthesis of arachidonic acid (20:4 Δ5, s' n' ) from palmitic acid (Cι6) is shown in Figure 1. A key enzyme in this pathway is a Δ5-desaturase which converts DH-γ-linolenic acid (DGLA, eicosatrienoic acid) to ARA. Conversion of α-linolenic acid (ALA) to stearidonic acid by a Δ6-desaturase is also shown. Production of PUFAs in addition to ARA, including EPA and DHA is shown in Figure 2.
SOURCES OF POLYPEPTIDES HAVING DESATURASE ACTIVITY A source of polypeptides having desaturase activity and oligonucleotides encoding such polypeptides are organisms which produce a desired polyunsaturated fatty acid. As an example, microorganisms having an ability to produce ARA can be used as a source of Δ5-desaturase activity. Such microorganisms include, for example, those belonging to the genera Mortierella, Conidiobolus, Pythium, Phytophathora, Penicillium,
Porphyridium, Coidosporium, Mucor, Fusarium, Aspergillus, Rhodotorula, and Entomophthora. Within the genus Porphyridium, of particular interest is Porphyridium cruentum. Within the genus Mortierella, of particular interest are Mortierella elongata, Mortierella exigua, Mortierella hygrophila, Mortierella ramanniana, var. angulispora, and Mortierella alpina. Within the genus Mucor, of particular interest are Mucor circinelloides and Mucor javanicus.
DNAs encoding desired desaturases can be identified in a variety of ways. As an example, a source of the desired desaturase, for example genomic or cDNA libraries from Mortierella, is screened with detectable enzymatically- or chemically-synthesized probes, which can be made from DNA, RNA, or non- naturally occurring nucleotides, or mixtures thereof. Probes may be enzymatically synthesized from DNAs of known desaturases for normal or reduced-stringency hybridization methods. Oligonucleotide probes also can be used to screen sources and can be based on sequences of known desaturases, including sequences conserved among known desaturases, or on peptide sequences obtained from the desired purified protein. Oligonucleotide probes based on amino acid sequences can be degenerate to encompass the degeneracy of the genetic code, or can be biased in favor of the preferred codons of the source organism. Oligonucleotides also can be used as primers for PCR from reverse transcribed mRNA from a known or suspected source; the PCR product can be the full length cDNA or can be used to generate a probe to obtain the desired full length cDNA. Alternatively, a desired protein can be entirely sequenced and total synthesis of a DNA encoding that polypeptide performed.
Once the desired genomic or cDNA has been isolated, it can be sequenced by known methods. It is recognized in the art that such methods are subject to errors, such that multiple sequencing of the same region is routine and is still expected to lead to measurable rates of mistakes in the resulting deduced sequence, particularly in regions having repeated domains, extensive secondary structure, or unusual base compositions, such as regions with high GC base content. When discrepancies arise, resequencing can be done and can employ special methods. Special methods can include altering sequencing conditions by using: different temperatures; different enzymes; proteins which alter the ability of oligonucleotides to form higher order structures; altered nucleotides such as ITP or methylated dGTP; different gel compositions, for example adding formamide; different primers or primers located at different distances from the problem region; or different templates such as single stranded DNAs. Sequencing of mRNA also can be employed.
For the most part, some or all of the coding sequence for the polypeptide having desaturase activity is from a natural source. In some situations, however, it is desirable to modify all or a portion of the codons, for example, to enhance expression, by employing host preferred codons. Host preferred codons can be determined from the codons of highest frequency in the proteins expressed in the largest amount in a particular host species of interest. Thus, the coding sequence for a polypeptide having desaturase activity can be synthesized in whole or in part. All or portions of the DNA also can be synthesized to remove any destabilizing sequences or regions of secondary structure which would be present in the transcribed mRNA. All or portions of the DNA also can be synthesized to alter the base composition to one more preferable in the desired host cell. Methods for synthesizing sequences and bringing sequences together are well established in the literature. In vitro mutagenesis and selection, site-directed mutagenesis, or other means can be employed to obtain mutations of naturally occurring desaturase genes to produce a polypeptide having desaturase activity in vivo with more desirable physical and kinetic parameters for function in the host cell, such as a longer half-life or a higher rate of production of a desired polyunsaturated fatty acid.
Mortierella alpina Desaturase
Of particular interest is the Mortierella alpina Δ5-desaturase which has
446 amino acids; the amino acid sequence is shown in Figure 3. The gene encoding the Mortierella alpina Δ5-desaturase can be expressed in transgenic microorganisms or animals to effect greater synthesis of ARA from DGLA. Other DNAs which are substantially identical to the Mortierella alpina Δ5- desaturase DNA, or which encode polypeptides which are substantially identical to the Mortierella alpina Δ5-desaturase polypeptide, also can be used. By substantially identical is intended an amino acid sequence or nucleic acid sequence exhibiting in order of increasing preference at least 60%, 80%, 90% or 95% homology to the Mortierella alpina Δ5-desaturase amino acid sequence or nucleic acid sequence encoding the amino acid sequence. For polypeptides, the length of comparison sequences generally is at least 16 amino acids, preferably at least 20 amino acids, or most preferably 35 amino acids. For nucleic acids, the length of comparison sequences generally is at least 50 nucleotides, preferably at least 60 nucleotides, and more preferably at least 75 nucleotides, and most preferably, 110 nucleotides. Homology typically is measured using sequence analysis software, for example, the Sequence Analysis software package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wisconsin 53705, MEGAlign (DNAStar, Inc., 1228 S. Park St., Madison, Wisconsin 53715), and Mac Vector (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite 200, Campbell, California 95008). Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid, glutamic acid, asparagine, and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Substitutions may also be made on the basis of conserved hydrophobicity or hydrophilicity (Kyte and Doolittle, J. Mol. Biol. 157: 105-132, 1982), or on the basis of the ability to assume similar polypeptide secondary structure (Chou and Fasman, Adv. Enzymol. 47: 45-148, 1978).
Other Desaturases
Encompassed by the present invention are related desaturases from the same or other organisms. Such related desaturases include variants of the disclosed Δ5-desaturase naturally occurring within the same or different species of Mortierella, as well as homologues of the disclosed Δ5-desaturase from other species. Also included are desaturases which, although not substantially identical to the Mortierella alpina Δ5-desaturase, desaturate a fatty acid molecule at carbon 5 from the carboxyl end of a fatty acid molecule. Related desaturases can be identified by their ability to function substantially the same as the disclosed desaturases; that is, are still able to effectively convert DGLA to ARA. Related desaturases also can be identified by screening sequence databases for sequences homologous to the disclosed desaturase, by hybridization of a probe based on the disclosed desaturase to a library constructed from the source organism, or by RT-PCR using mRNA from the source organism and primers based on the disclosed desaturase. Such desaturases include those from humans, Dictyostelium discoideum and Phaeodactylum tricornum.
The regions of a desaturase polypeptide important for desaturase activity can be determined through routine mutagenesis, expression of the resulting mutant polypeptides and determination of their activities. Mutants may include deletions, insertions and point mutations, or combinations thereof. A typical functional analysis begins with deletion mutagenesis to determine the N- and C- terminal limits of the protein necessary for function, and then internal deletions, insertions or point mutants are made to further determine regions necessary for function. Other techniques such as cassette mutagenesis or total synthesis also can be used. Deletion mutagenesis is accomplished, for example, by using exonucleases to sequentially remove the 5' or 3' coding regions. Kits are available for such techniques. After deletion, the coding region is completed by ligating oligonucleotides containing start or stop codons to the deleted coding region after 5' or 3' deletion, respectively. Alternatively, oligonucleotides encoding start or stop codons are inserted into the coding region by a variety of methods including site-directed mutagenesis, mutagenic PCR or by ligation onto DNA digested at existing restriction sites. Internal deletions can similarly be made through a variety of methods including the use of existing restriction sites in the DNA, by use of mutagenic primers via site directed mutagenesis or mutagenic PCR. Insertions are made through methods such as linker-scanning mutagenesis, site-directed mutagenesis or mutagenic PCR. Point mutations are made through techniques such as site-directed mutagenesis or mutagenic PCR.
Chemical mutagenesis also can be used for identifying regions of a desaturase polypeptide important for activity. A mutated construct is expressed, and the ability of the resulting altered protein to function as a desaturase is assayed. Such structure-function analysis can determine which regions may be deleted, which regions tolerate insertions, and which point mutations allow the mutant protein to function in substantially the same way as the native desaturase. All such mutant proteins and nucleotide sequences encoding them are within the scope of the present invention.
EXPRESSION OF DESATURASE GENES
Once the DNA encoding a desaturase polypeptide has been obtained, it is placed in a vector capable of replication in a host cell, or is propagated in vitro by means of techniques such as PCR or long PCR. Replicating vectors can include plasmids, phage, viruses, cosmids and the like. Desirable vectors include those useful for mutagenesis of the gene of interest or for expression of the gene of interest in host cells. The technique of long PCR has made in vitro propagation of large constructs possible, so that modifications to the gene of interest, such as mutagenesis or addition of expression signals, and propagation of the resulting constructs can occur entirely in vitro without the use of a replicating vector or a host cell.
For expression of a desaturase polypeptide, functional transcriptional and translational initiation and termination regions are operably linked to the DNA encoding the desaturase polypeptide. Expression of the polypeptide coding region can take place in vitro or in a host cell. Transcriptional and translational initiation and termination regions are derived from a variety of nonexclusive sources, including the DNA to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous locus in a host cell.
Expression In Vitro
In vitro expression can be accomplished, for example, by placing the coding region for the desaturase polypeptide in an expression vector designed for in vitro use and adding rabbit reticulocyte lysate and cofactors; labeled amino acids can be incorporated if desired. Such in vitro expression vectors may provide some or all of the expression signals necessary in the system used. These methods are well known in the art and the components of the system are commercially available. The reaction mixture can then be assayed directly for the polypeptide, for example by determining its activity, or the synthesized polypeptide can be purified and then assayed.
Expression In A Host Cell
Expression in a host cell can be accomplished in a transient or stable fashion. Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not replicate and rarely integrate in the host cell, or where the host cell is not proliferating. Transient expression also can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems frequently exhibit a low basal level of expression. Stable expression can be achieved by introduction of a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected for through the use of a selectable marker located on or transfected with the expression construct, followed by selection for cells expressing the marker. When stable expression results from integration, integration of constructs can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, all or some of the transcriptional and translational regulatory regions can be provided by the endogenous locus.
When increased expression of the desaturase polypeptide in the source organism is desired, several methods can be employed. Additional genes encoding the desaturase polypeptide can be introduced into the host organism. Expression from the native desaturase locus also can be increased through homologous recombination, for example by inserting a stronger promoter into the host genome to cause increased expression, by removing destabilizing sequences from either the mRNA or the encoded protein by deleting that information from the host genome, or by adding stabilizing sequences to the mRNA (USPN 4,910,141). When it is desirable to express more than one different gene, appropriate regulatory regions and expression methods, introduced genes can be propagated in the host cell through use of replicating vectors or by integration into the host genome. Where two or more genes are expressed from separate replicating vectors, it is desirable that each vector has a different means of replication. Each introduced construct, whether integrated or not, should have a different means of selection and should lack homology to the other constructs to maintain stable expression and prevent reassortment of elements among constructs. Judicious choices of regulatory regions, selection means and method of propagation of the introduced construct can be experimentally determined so that all introduced genes are expressed at the necessary levels to provide for synthesis of the desired products. INTRODUCTION OF CONSTRUCTS INTO HOST CELLS
Constructs comprising the gene of interest may be introduced into a host cell by standard techniques. These techniques include transformation, protoplast fusion, lipofection, transfection, transduction, conjugation, infection, holistic impact, electroporation, microinjection, scraping, or any other method which introduces the gene of interest into the host cell. Methods of transformation which are used include lithium acetate transformation (Methods in Enzymology, Vol. 194, p. 186-187, 1991). For convenience, a host cell which has been manipulated by any method to take up a DNA sequence or construct will be referred to as "transformed" or "recombinant" herein.
The subject host will have at least have one copy of the expression construct and may have two or more, depending upon whether the gene is integrated into the genome, amplified, or is present on an extrachromosomal element having multiple copy numbers. Where the subject host is a yeast, four principal types of yeast plasmid vectors can be used: Yeast Integrating plasmids (Yips), Yeast Replicating plasmids (YRps), Yeast Centromere plasmids (YCps), and Yeast Episomal plasmids (YEps). Yips lack a yeast replication origin and must be propagated as integrated elements in the yeast genome. YRps have a chromosomally derived autonomously replicating sequence and are propagated as medium copy number (20 to 40), autonomously replicating, unstably segregating plasmids. YCps have both a replication origin and a centromere sequence and propagate as low copy number (10-20), autonomously replicating, stably segregating plasmids. YEps have an origin of replication from the yeast 2μm plasmid and are propagated as high copy number, autonomously replicating, irregularly segregating plasmids. The presence of the plasmids in yeast can be ensured by maintaining selection for a marker on the plasmid. Of particular interest are the yeast vectors pYES2 (a YEp plasmid available from Invitrogen, confers uracil prototrophy and a GAL1 galactose- inducible promoter for expression), pRS425-pGl (a YEp plasmid obtained from Dr. T. H. Chang, Ass. Professor of Molecular Genetics, Ohio State University, containing a constitutive GPD promoter and conferring leucine prototrophy), and pYX424 (a YEp plasmid having a constitutive TP1 promoter and conferring leucine prototrophy; Alber, T. and Kawasaki, G. (1982). J. Mol. & Appl. Genetics 1: 419). The transformed host cell can be identified by selection for a marker contained on the introduced construct. Alternatively, a separate marker construct may be introduced with the desired construct, as many transformation techniques introduce many DNA molecules into host cells. Typically, transformed hosts are selected for their ability to grow on selective media. Selective media may incorporate an antibiotic or lack a factor necessary for growth of the untransformed host, such as a nutrient or growth factor. An introduced marker gene therefor may confer antibiotic resistance, or encode an essential growth factor or enzyme, and permit growth on selective media when expressed in the transformed host. Selection of a transformed host also can occur when the expressed marker protein can be detected, either directly or indirectly. The marker protein may be expressed alone or as a fusion to another protein. The marker protein can be detected by its enzymatic activity; for example β galactosidase can convert the substrate X-gal to a colored product, and luciferase can convert luciferin to a light-emitting product. The marker protein can be detected by its light-producing or modifying characteristics; for example, the green fluorescent protein of Aequorea victoria fluoresces when illuminated with blue light. Antibodies can be used to detect the marker protein or a molecular tag on, for example, a protein of interest. Cells expressing the marker protein or tag can be selected, for example, visually, or by techniques such as FACS or panning using antibodies. For selection of yeast transformants, any marker that functions in yeast may be used. Desirably, resistance to kanamycin and the amino glycoside G418 are of interest, as well as ability to grow on media lacking uracil, leucine, lysine or tryptophan.
The Δ5-desaturase-mediated production of PUFAs can be performed in either prokaryotic or eukaryotic host cells. Prokaryotic cells of interest include Eschericia, Bacillus, Lactobacillus, cyanobacteria and the like. Eukaryotic cells include mammalian cells such as those of lactating animals, avian cells such as of chickens, and other cells amenable to genetic manipulation including insect, fungal, and algae cells. The cells may be cultured or formed as part or all of a host organism including an animal. Viruses and bacteriophage also may be used with the cells in the production of PUFAs, particularly for gene transfer, cellular targeting and selection. In a preferred embodiment, the host is any microorganism or animal which produces DGLA and/or can assimilate exogenously supplied DGLA, and preferably produces large amounts of DGLA. Examples of host animals include mice, rats, rabbits, chickens, quail, turkeys, bovines, sheep, pigs, goats, yaks, etc., which are amenable to genetic manipulation and cloning for rapid expansion of the transgene expressing population. For animals, a Δ5-desaturase transgene can be adapted for expression in target organdies, tissues and body fluids through modification of the gene regulatory regions. Of particular interest is the production of PUFAs in the breast milk of the host animal.
Expression In Insect Cells
Production of PUFAs in insect cells can be conducted using baculovirus expression vectors harboring a Δ5-desaturase transgene as detailed in the Example section below. Examples of host systems include Spodoptera frugiperda, (Sf9 and Sf21 cells) and cabbag lopper moth Trichoplusia ni (Hi Five Cells).
Use of the baculovirus expression system in transgenic insect cells offers a number of advantages in PUFA production. Baculovirus expression systems are high level gene expression systems capable of post translational modifications similar to mammalian cells. The expression system allows for genetic manipulation with relative ease in comparison to mammalian cell transfections. By using site-specific transposition and eliminating the potential mix of parental and nonrecombinant baculoviruses, there is no need for multiple rounds of plaque purification. This greatly reduces the time it takes to identify and purify a recombinant virus. This system also offers the advantage of supporting coexpression of gene products encoded by different recombinant baculovirus vectors in a single infection.
Expression in Algae Cells
Methods for producing hybrid and transgenic strains of algae, such as marine algae, which contain and express a desaturase transgene also are provided. For example, transgenic marine algae may be prepared as described in USPN 5,426,040. As with the other expression systems described above, the timing, extent of expression and activity of the desaturase transgene can be regulated by fitting the polypeptide coding sequence with the appropriate transcriptional and translational regulatory regions selected for a particular use. Of particular interest are promoter regions which can be induced under preselected growth conditions. For example, introduction of temperature sensitive and/or metabolite responsive mutations into the desaturase transgene coding sequences, its regulatory regions, and/or the genome of cells into which the transgene is introduced can be used for this purpose.
The transformed host cell is grown under appropriate conditions adapted for a desired end result. For host cells grown in culture, the conditions are typically optimized to produce the greatest or most economical yield of PUFAs, which relates to the selected desaturase activity. Media conditions which may be optimized include: carbon source, nitrogen source, addition of substrate, final concentration of added substrate, form of substrate added, aerobic or anaerobic growth, growth temperature, inducing agent, induction temperature, growth phase at induction, growth phase at harvest, pH, density, and maintenance of selection. Microorganisms of interest, such as yeast and algae are preferably grown in selected medium. For yeast, complex media such as peptone broth (YPD) or a defined media such as a minimal media (contains amino acids, yeast nitrogen base, and ammonium sulfate, and lacks a component for selection, for example uracil) are preferred. Desirably, substrates to be added are first dissolved in ethanol. Where necessary, expression of the polypeptide of interest may be induced, for example by including or adding galactose to induce expression from a GAL promoter. Expression In Animals And Animal Cells
Expression in cells of a host animal can likewise be accomplished in a transient or stable manner. Transient expression can be accomplished via known methods, for example infection or lipofection, and can be repeated in order to maintain desired expression levels of the introduced construct (see Ebert, PCT publication WO 94/05782). Stable expression can be accomplished via integration of a construct into the host genome, resulting in a transgenic animal. The construct can be introduced, for example, by microinjection of the construct into the pronuclei of a fertilized egg, or by transfection, retroviral infection or other techniques whereby the construct is introduced into a cell line which may form or be incorporated into an adult animal (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S. Patent No. 5,565,362; U.S. Patent No. 5,366,894; Wilmut et al. (1997) Nature 385:810). The recombinant eggs or embryos are transferred to a surrogate mother (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S. Patent No. 5,565,362; U.S. Patent No. 5,366,894; Wilmut et al. (supra)).
After birth, transgenic animals are identified, for example, by the presence of an introduced marker gene, such as for coat color, or by PCR or Southern blotting from a blood, milk or tissue sample to detect the introduced construct, or by an immunological or enzymological assay to detect the expressed protein or the products produced therefrom (U.S. Patent No. 4,873,191; U.S. Patent No. 5,530,177; U.S. Patent No. 5,565,362; U.S. Patent No. 5,366,894; Wilmut et al. (supra)). The resulting transgenic animals may be entirely transgenic or may be mosaics, having the transgenes in only a subset of their cells. The advent of mammalian cloning, accomplished by fusing a nucleated cell with an enucleated egg, followed by transfer into a surrogate mother, presents the possibility of rapid, large-scale production upon obtaining a "founder" animal or cell comprising the introduced construct; prior to this, it was necessary for the transgene to be present in the germ line of the animal for propagation (Wilmut et al. (supra)). Expression in a host animal presents certain efficiencies, particularly where the host is a domesticated animal. For production of PUFAs in a fluid readily obtainable from the host animal, such as milk, the desaturase transgene can be expressed in mammary cells from a female host, and the PUFA content of the host cells altered. The desaturase transgene can be adapted for expression so that it is retained in the mammary cells, or secreted into milk, to form the PUFA reaction products localized to the milk (PCT publication WO 95/24488). Expression can be targeted for expression in mammary tissue using specific regulatory sequences, such as those of bovine α-lactalbumin, α-casein, β- casein, γ-casein, κ-casein, β-lactoglobulin, or whey acidic protein, and may optionally include one or more introns and/or secretory signal sequences (U.S. Patent No. 5,530,177; Rosen, U.S. Patent No. 5,565,362; Clark et al, U.S. Patent No. 5,366,894; Garner et al., PCT publication WO 95/23868). Expression of desaturase transgenes, or antisense desaturase transcripts, adapted in this manner can be used to alter the levels of specific PUFAs, or derivatives thereof, found in the animals milk. Additionally, the Δ5-desaturase transgene can be expressed either by itself or with other transgenes, in order to produce animal milk containing higher proportions of desired PUFAs or PUFA ratios and concentrations that resemble human breast milk (Prieto et al. , PCT publication WO 95/24494).
PURIFICATION OF Δ5 DESATURASES
Recombinant Δ5 desaturase may be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography and hydrophobic interaction chromatography. Insect cell produced Δ5 desaturase is a particularly good source of the purified enzyme. The purified Δ5 desaturase may be used for the production of monoclonal and polyclonal antibodies.
In addition, recombinant Δ5 desaturase can be separated from other cellular proteins by use of an immuno-affmity column made with monoclonal or polyclonal antibodies specific for full length Δ5 desaturase or polypeptide fragments of Δ5 desaturase.
Δ5 DESATURASE ANTIBODIES
Monospecific antibodies to Δ5 desaturase are purified from mammalian antisera containing antibodies reactive against Δ5 desaturase or are prepared as monoclonal antibodies reactive with Δ5 desaturase, using procedures well known in the art such as the technique of Kohler and Milstein, Nature 256: 495-497 (1975). Monospecific antibody as used herein is defined as a single antibody species with homogenous binding characteristics for Δ5 desaturase. Homogenous binding as used herein refers to the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with the Δ5 desaturase, as described above. Δ5 desaturase specific antibodies are raised by immunizing animals such as mice, rate, guinea pigs, rabbits, goats, horses and the like, with an appropriate concentration of Δ5 desaturase either with or without an immune adjuvant.
Polyclonal Antibodies
Preimmune serum is collected prior to the first immunization. Each animal receives between about 0.1 μg and about 1000 μg of Δ5 desaturase associated with an acceptable immune adjuvant. Such acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum- precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA. The initial immunization consists of the Δ5 desaturase protein in, preferably, Freund's complete adjuvant at multiple sites either subcutaneously (SC), intraperitoneally (IP) or both. Each animal is bled at regular intervals, preferably weekly, to determine antibody titer. The animals may or may not receive booster injections following the initial immunization. Those animals receiving booster injections are generally given an equal amount of Δ5 desaturase in Freund's incomplete adjuvant by the same route. Booster injections are given at about three week intervals until the maximal titers are obtained. At about 7 days after each booster immunization or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about -20° C.
Monoclonal Antibodies
Monoclonal antibodies (mAb) reactive with Δ5 desaturase are prepared by immunizing inbred mice, preferably Balb/c, with purified Δ5 desaturase . The mice are immunized by the IP or SC route with about 1 μg to about 100 μg, preferably about 10 μg, of Δ5 desaturase in about 0.5 ml buffer or saline incorporated in an equal volume of an acceptable adjuvant, as discussed above. Freund's complete adjuvant is preferred. The mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks.
Immunized mice are given one or more booster immunizations of about 1 to about 100 μg of Δ5 desaturase in a buffer solution such as phosphate buffered saline by the intravenous (LV) route. Lymphocytes, from antibody positive mice, preferably splenic lymphocytes, are obtained by removing spleens from immunized mice by standard procedures known in the art. Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner, preferably myeloma cells, under conditions which will allow the formation of stable hybridomas. Fusion partners may include, but are not limited to: mouse myelomas P3/NSl/Ag 4-1; MPC-11; S-104 and Sp 2/0, with Sp 2/0 being preferred.
The antibody producing cells and myeloma cells are fused in polyethylene glycol, about 1000 mol. wt., at concentrations from about 30% to about 50%. Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art. Supernatant fluids are collect from growth positive wells on about days 14, 18 and 21 and are screened for Δ5 desaturase antibody production by an immunoassay such as solid phase immunoradioassay (SPLRA) using Δ5 desaturase as the antigen. The culture fluids are also tested in the Ouchterlony precipitation assay to determine the isotype of the mAb. Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973.
Monoclonal antibodies are produced in vivo by injection of pristane primed Balb/c mice, approximately 0.5 ml per mouse, with about 2 x 106 to about 6 x 106 hybridoma cells about 4 days after priming. Ascites fluid is collected at approximately 8-12 days after cell transfer and the monoclonal antibodies are purified by techniques known in the art.
In vitro production of anti-Δ5 desaturase mAb is carried out by growing the hydridoma in DMEM containing about 2% fetal calf serum to obtain sufficient quantities of the specific mAb. The mAb are purified by techniques known in the art.
Antibody titers of ascites or hybridoma culture fluids are determined by various serological or immunological assays which include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique and radioimmunoassay (RIA) techniques. Similar assays are used to detect the presence of Δ5 desaturases in body fluids or tissue and cell extracts.
It is readily apparent to those skilled in the art that the above described methods for producing monospecific antibodies may be utilized to produce antibodies specific for Δ5 desaturase polypeptide fragments, or full-length Δ5 desaturase polypeptide.
Δ5 desaturase antibody affinity columns are made by adding the antibodies to Affigel-10 (Biorad), a gel support which is pre-activated with N- hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with the spacer arm. The remaining activated esters are then quenched with 1M ethanolamine HCI (pH 8). The column is washed with water followed by 0.23M glycine HCI (pH 2.6) to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (pH 7.3) and the cell culture supernatants or cell ex tracts containing Δ5 desaturase or Δ5 desaturase fragments are slowly passed through the column. The column is then washed with phospate buffered saline until the optical density (A280) falls to background, then the protein is eluted with 0.23M glycine-HCI (pH 2.6). The purified Δ5 desaturase protein is then dialyzed against phosphate buffered saline.
PURIFICATION OF FATTY ACIDS
The fatty acids desaturated in the Δ5 position may be found in the host microorganism or animal as free fatty acids or in conjugated forms such as acylglycerols, phospholipids, sulfolipids or glycolipids, and may be extracted from the host cell through a variety of means well-known in the art. Such means may include extraction with organic solvents, sonication, supercritical fluid extraction using for example carbon dioxide, and physical means such as presses, or combinations thereof. Of particular interest is extraction with methanol and chloroform. Where desirable, the aqueous layer can be acidified to protonate negatively charged moieties and thereby increase partitioning of desired products into the organic layer. After extraction, the organic solvents can be removed by evaporation under a stream of nitrogen. When isolated in conjugated forms, the products may be enzymatically or chemically cleaved to release the free fatty acid or a less complex conjugate of interest, and can then be subject to further manipulations to produce a desired end product. Desirably, conjugated forms of fatty acids are cleaved with potassium hydroxide.
If further purification is necessary, standard methods can be employed.
Such methods may include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography, high speed centrifugation or distillation, or combinations of these techniques.
Protection of reactive groups, such as the acid or alkenyl groups, may be done at any step through known techniques, for example alkylation or iodination.
Methods used include methylation of the fatty acids to produce methyl esters. Similarly, protecting groups may be removed at any step. Desirably, purification of fractions containing ARA, DHA and EPA may be accomplished by treatment with urea and/or fractional distillation.
USES OF FATTY ACIDS
There are several uses for fatty acids of the subject invention. Probes based on the DNAs of the present invention may find use in methods for isolating related molecules or in methods to detect organisms expressing desaturases. When used as probes, the DNAs or oligonucleotides must be detectable. This is usually accomplished by attaching a label either at an internal site, for example via incoφoration of a modified residue, or at the 5' or 3' terminus. Such labels can be directly detectable, can bind to a secondary molecule that is detectably labeled, or can bind to an unlabelled secondary molecule and a detectably labeled tertiary molecule; this process can be extended as long as is practical to achieve a satisfactorily detectable signal without unacceptable levels of background signal. Secondary, tertiary, or bridging systems can include use of antibodies directed against any other molecule, including labels or other antibodies, or can involve any molecules which bind to each other, for example a biotin-streptavidin/avidin system. Detectable labels typically include radioactive isotopes, molecules which chemically or enzymatically produce or alter light, enzymes which produce detectable reaction products, magnetic molecules, fluorescent molecules or molecules whose fluorescence or light-emitting characteristics change upon binding. Examples of labelling methods can be found in USPN 5,011,770. Alternatively, the binding of target molecules can be directly detected by measuring the change in heat of solution on binding of probe to target via isothermal titration calorimetry, or by coating the probe or target on a surface and detecting the change in scattering of light from the surface produced by binding of target or probe, respectively, as may be done with the BIAcore system.
PUFAs produced by recombinant means find applications in a wide variety of areas. Supplementation of humans or animals with PUFAs in various forms can result in increased levels not only of the added PUFAs, but of their metabolic progeny as well. For example, where the inherent Δ5-desaturase pathway is dysfunctional in an individual, treatment with ARA can result not only in increased levels of ARA, but also of downstream products of ARA such as prostaglandins (see Figure 1). Complex regulatory mechanisms can make it desirable to combine various PUFAs, or to add different conjugates of PUFAs, in order to prevent, control or overcome such mechanisms to achieve the desired levels of specific PUFAs in an individual.
FATTY ACID COMPOSITIONS
The present invention also includes fatty acid compositions such as nutritional compositions. Such compositions, for purposes of the present invention, include any food or preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function. The nutritional composition of the present invention comprises at least one oil or acid produced in accordance with the present invention and may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins and minerals in amounts desired for a particular use. The amount of such ingredients will vary depending on whether the composition is intended for use with normal, healthy infants, children or adults having specialized needs such as those which accompany certain metabolic conditions (e.g., metabolic disorders).
Examples of macronutrients which may be added to the composition include but are not limited to edible fats, carbohydrates and proteins. Examples of such edible fats include but are not limited to coconut oil, soy oil, and mono- and diglycerides. Examples of such carbohydrates include but are not limited to glucose, edible lactose and hydrolyzed starch. Additionally, examples of proteins which may be utilized in the nutritional composition of the invention include but are not limited to soy proteins, electrodialysed whey , electrodialysed skim milk, milk whey, or the hydrolysates of these proteins. With respect to vitamins and minerals, the following may be added to the nutritional compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
The components utilized in the nutritional compositions of the present invention will of semi-purified or purified origin. By semi-purified or purified is meant a material which has been prepared by purification of a natural material or by synthesis. Examples of nutritional compositions of the present invention include but are not limited to infant formulas, dietary supplements, and rehydration compositions. Nutritional compositions of particular interest include but are not limited to those utilized for enteral and parenteral supplementation for infants, specialist infant formulae, supplements for the elderly, and supplements for those with gastrointestinal difficulties and/or malabsorption.
Nutritional Compositions
A typical nutritional composition of the present invention will contain edible macronutrients, vitamins and minerals in amounts desired for a particular use. The amounts of such ingredients will vary depending on whether the formulation is intended for use with normal, healthy individuals temporarily exposed to stress, or to subjects having specialized needs due to certain chronic or acute disease states (e.g., metabolic disorders). It will be understood by persons skilled in the art that the components utilized in a nutritional formulation of the present invention are of semi-purified or purified origin. By semi-purified or purified is meant a material that has been prepared by purification of a natural material or by synthesis. These techniques are well known in the art (See, e.g., Code of Federal Regulations for Food Ingredients and Food Processing; Recommended Dietary Allowances, 10th Ed., National Academy Press, Washington, D.C., 1989). In a preferred embodiment, a nutritional formulation of the present invention is an enteral nutritional product, more preferably an adult or child enteral nutritional product. Accordingly in a further aspect of the invention, a nutritional formulation is provided that is suitable for feeding adults, who are experiencing stress. The formula comprises, in addition to the PUFAs of the invention; macronutrients, vitamins and minerals in amounts designed to provide the daily nutritional requirements of adults.
The macronutritional components include edible fats, carbohydrates and proteins. Exemplary edible fats are coconut oil, soy oil, and mono- and diglycerides and the PUFA oils of this invention. Exemplary carbohydrates are glucose, edible lactose and hydrolyzed cornstarch. A typical protein source would be soy protein, electrodialysed whey or electrodialysed skim milk or milk whey, or the hydrolysates of these proteins, although other protein sources are also available and may be used. These macronutrients would be added in the form of commonly accepted nutritional compounds in amount equivalent to those present in human milk or an energy basis, i.e., on a per calorie basis.
Methods for formulating liquid and enteral nutritional formulas are well known in the art and are described in detail in the examples.
The enteral formula can be sterilized and subsequently utilized on a ready-to-feed (RTF) basis or stored in a concentrated liquid or a powder. The powder can be prepared by spray drying the enteral formula prepared as indicated above, and the formula can be reconstituted by rehydrating the concentrate. Adult and infant nutritional formulas are well known in the art and commercially available (e.g., Similac®, Ensure®, Jevity® and Alimentum® from Ross Products Division, Abbott Laboratories). An oil or acid of the present invention can be added to any of these formulas in the amounts described below.
The energy density of the nutritional composition when in liquid form, can typically range from about 0.6 Kcal to 3.0 Kcal per ml. When in solid or powdered form, the nutritional supplement can contain from about 1.2 to more than 9 Kcals per gm, preferably 3 to 7 Kcals per gram. In general, the osmolality of a liquid product should be less than 700 mOsm and more preferably less than 660 mOsm.
The nutritional formula would typically include vitamins and minerals, in addition to the PUFAs of the invention, in order to help the individual ingest the minimum daily requirements for these substances. In addition to the PUFAs listed above, it may also be desirable to supplement the nutritional composition with zinc, copper, and folic acid in addition to antioxidants. It is believed that these substances will also provide a boost to the stressed immune system and thus will provide further benefits to the individual. The presence of zinc, copper or folic acid is optional and is not required in order to gain the beneficial effects on immune suppression. Likewise a pharmaceutical composition can be supplemented with these same substances as well.
In a more preferred embodiment, the nutritional contains, in addition to the antioxidant system and the PUFA component, a source of carbohydrate wherein at least 5 weight % of said carbohydrate is an indigestible oligosaccharide. In yet a more preferred embodiment, the nutritional composition additionally contains protein, taurine and carnitine.
The PUFAs, or derivatives thereof, made by the disclosed method can be used as dietary substitutes, or supplements, particularly infant formulas, for patients undergoing intravenous feeding or for preventing or treating malnutrition. Typically, human breast milk has a fatty acid profile comprising from about 0.15 % to about 0.36 % as DHA, from about 0.03 % to about 0.13 % as EPA, from about 0.30 % to about 0.88 % as ARA, from about 0.22 % to about 0.67 % as DGLA, and from about 0.27 % to about 1.04 % as GLA. Additionally, the predominant triglyceride in human milk has been reported to be l,3-di-oleoyl-2-palmitoyl, with 2-palmitoyl glycerides reported as better absorbed than 2-oleoyl or 2-lineoyl glycerides (USPN 4,876,107). Thus, fatty acids such as ARA, DGLA, GLA and/or EPA produced by the invention can be used to alter the composition of infant formulas to better replicate the PUFA composition of human breast milk. In particular, an oil composition for use in a pharmacologic or food supplement, particularly a breast milk substitute or supplement, will preferably comprise one or more of ARA, DGLA and GLA. More preferably the oil will comprise from about 0.3 to 30% ARA, from about 0.2 to 30% DGLA, and from about 0.2 to about 30% GLA.
In addition to the concentration, the ratios of ARA, DGLA and GLA can be adapted for a particular given end use. When formulated as a breast milk supplement, or substitute an oil composition which contains two or more of ARA, DGLA and GLA will be provided in a ratio of about 1 : 19:30 to about 6: 1:0.2, respectively. For example, the breast milk of animals can vary in ratios of ARA:DGLA:DGL ranging from 1:19:30 to 6: 1:0.2, which includes intermediate ratios which are preferably about 1:1:1, 1:2:1, 1:1:4. When produced together in a host cell, adjusting the rate and percent of conversion of a precursor substrate such as GLA and DGLA to ARA can be used to precisely control the PUFA ratios. For example, a 5% to 10% conversion rate of DGLA to ARA can be used to produce an ARA to DGLA ratio of about 1: 19, whereas a conversion rate of about 75% to 80% can be used to produce an ARA to DGLA ratio of about 6: 1. Therefore, whether in a cell culture system or in a host animal, regulating the timing, extent and specificity of desaturase expression as described can be used to modulate the PUFA levels and ratios. Depending on the expression system used, e.g., cell culture or an animal expressing oil(s) in its milk, the oils also can be isolated and recombined in the desired concentrations and ratios. Amounts of oils providing these ratios of PUFA can be determined following standard protocols. PUFAs, or host cells containing them, also can be used as animal food supplements to alter an animal's tissue or milk fatty acid composition to one more desirable for human or animal consumption.
For dietary supplementation, the purified PUFAs, or derivatives thereof, may be incorporated into cooking oils, fats or margarines formulated so that in normal use the recipient would receive the desired amount. The PUFAs may also be incorporated into infant formulas, nutritional supplements or other food products, and may find use as anti-inflammatory or cholesterol lowering agents. Pharmaceutical Compositions
The present invention also encompasses a pharmaceutical composition comprising one or more of the acids and/or resulting oils produced in accordance with the methods described herein. More specifically, such a pharmaceutical composition may comprise one or more of the acids and/or oils as well as a standard, well-known, non-toxic pharmaceutically acceptable carrier, adjuvant or vehicle such as, for example, phosphate buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent or an emulsion such as a water/oil emulsion. The composition may be in either a liquid or solid form. For example, the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectible, or topical ointment or cream.
Possible routes of administration include, for example, oral, rectal and parenteral. The route of administration will, of course, depend upon the desired effect. For example, if the composition is being utilized to treat rough, dry, or aging skin, to treat injured or burned skin, or to treat skin or hair affected by a disease or condition, it may perhaps be applied topically.
The dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient, age of the patient, immune status of the patient, etc.
With respect to form, the composition may be, for example, a solution, a dispersion, a suspension, an emulsion or a sterile powder which is then reconstituted.
Cosmetic Compositions
Additionally, the composition of the present invention may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic compositions such that a mixture is formed or may be used as a sole composition. The topical compositions into which PUFAs are formulated comprise a cosmetic or dermatological composition and can be provided in all conventional pharmaceutical dosage forms for topical application and the physiologically acceptable vehicle, diluent or carrier and therefore can be any standard vehicle or medium for a cosmetic or dermatological composition. The subject compositions can be formulated as an aqueous solution, or an oily suspension, or a dispersion of the lotion or serum type, or as an emulsion having a liquid or semi-liquid consistency of the milk type, obtained by dispersion of a fatty phase into an aqueous phase (O/W) or vice-versa (W/O), or as a suspension or emulsion having a soft consistency of the aquenous gel or cream type, or as microcapsules or microparticles, or as vesicular dispersions of ionic and/or nonionic type. These compositions are formulated according to the usual techniques.
The amounts of the different constituents of the compositions are those conventionally employed in the fields under consideration.
The subject compositions constitute, in particular, cleansing, protection, treatment or care creams for the face, for the hands, for the major anatomical folds or for the body (for example day creams, night creams, makeup removal creams, foundation creams or anti-sun or sunscreen creams), fluid foundations, makeup removal milks, protection or care body milks, anti-sun or sunscreen milks, or lotions, gels or foams for caring for the skin, such as cleansing lotions, anti-sun lotions, artificial tanning lotions, and the like.
When the composition is an emulsion, the proportion of the fatty phase can range from 5% to 80% by weight and preferably from 5% to 50% by weight with respect to the total weight of the composition. The oils, waxes, emulsifiers and coemulsifiers formulated into the composition in the emulsion form are those conventional in the cosmetics field. The emulsifier and the coemulsifier are advantageously present in such compositions in a proportion ranging from 0.3% to 30% by weight and preferably from 0.5% to 20% by weight with respect to the total weight of the composition. The emulsion can, in addition, contain lipid vesicles. The subject cosmetic or dermatological compositions can also contain adjuvants and additives usual in the cosmetics or dermatological field, such as hydrophilic or lipopyhilic gelling agents, hydrophilic or lipophilic additives, preservatives, antioxidants, solvents, fragrances, fillers, screening agents, odor absorbers and colorants. The amounts of these different adjuvants and additives are those conventional in these fields and, for example, range from 0.01% to 10% of the total weight of the composition. These adjuvants and additives, depending on their nature, can be introduced into the fatty phase, into the aqueous phase and/or into lipid spherules. Exemplary oils and waxes include mineral oils (liquid petrolatum), vegetable oils (liquid fraction of karite butter, sunflower oil), animal oils (perhydrosqualene), synthetic oils (Purcellin oil), silicone oils or waxes (cyclomethicone) and fluorinated oils (perfluoropolyethers), beeswax or carnauba or parafin wax. Fatty alcohols and fatty acids (stearic acid) can be added to these oils.
Exemplary emulsifiers include, for example, glycerol stearate, polysorbate 60 and the PEG-6/PEG-31 /glycol stearate mixture marketed under the trademark Tefose " 63 by Gattefosse.
Exemplary hydrophilic gelling agents according to the invention include the carboxyvinyl polymers (carbomer), acrylic copolymers, such as acrylate/alkyl acrylate copolymers, polyacrylamides, polysaccharides, such as hydroxypropylcellulose, natural gums and clays, and exemplary lipophilic gelling agents include the modified clays, such as bentones, or metal salts of fatty acids, such as aluminum stearates. Insofar as they do not interfere or interact with the activity of the melatonin, the compositions of the present invention can contain other active ingredients suitable, in particular, for the prevention and/or for the treatment of skin conditions/afflictions.
The compositions according to the invention are particularly well suited for preventing or treating oxidative stress of the skin and/or or its adnexa, in aprticular related to UV irradiation, to aging, to inflammation, to alopecia, and the like.
Administration of the Pharmaceutical Compositions Pharmaceutical compositions may be utilized to administer the PUFA component to an individual. Suitable pharmaceutical compositions may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions and sterile powders for reconstitution into sterile solutions or dispersions for ingestion. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents, for example sugars, sodium chloride and the like. Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents.
Suspensions, in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth or mixtures of these substances, and the like.
Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art. For example, PUFAs of the invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipients into a gelatin capsule along with the antioxidants and the PUFA component. The amount of the antioxidants and PUFA component that should be incorporated into the pharmaceutical formulation should fit within the guidelines discussed above.
As used in this application, the term "treat" refers to either preventing, or reducing the incidence of, the undesired occurrence. For example, to treat immune suppression refers to either preventing the occurrence of this suppression or reducing the amount of such suppression. The terms "patient" and "individual" are being used interchangeably and both refer to an animal. The term "animal" as used in this application refers to any warm-blooded mammal including, but not limited to, dogs, humans, monkeys, and apes. As used in the application the term "about" refers to an amount varying from the stated range or number by a reasonable amount depending upon the context of use. Any numerical number or range specified in the specification should be considered to be modified by the term about. "Dose" and "serving" are used interchangeably and refer to the amount of the nutritional or pharmaceutical composition ingested by the patient in a single setting and designed to deliver effective amounts of the antioxidants and the structured triglyceride. As will be readily apparent to those skilled in the art, a single dose or serving of the liquid nutritional powder should supply the amount of antioxidants and PUFAs discussed above. The amount of the dose or serving should be a volume that a typical adult can consume in one sitting. This amount can vary widely depending upon the age, weight, sex or medical condition of the patient. However as a general guideline, a single serving or dose of a liquid nutritional produce should be considered as encompassing a volume from 100 to 600 ml, more preferably from 125 to 500 ml and most preferably from 125 to 300 ml.
Food Products
The PUFAs of the present invention may also be added to food even when supplementation of the diet is not required. For example, the composition may be added to food of any type including but not limited to margarines, modified butters, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
Pharmaceutical Applications
Administration For pharmaceutical use (human or veterinary), the compositions are generally administered orally but can be administered by any route by which they may be successfully absorbed, e.g., parenterally (i.e. subcutaneously, intramuscularly or intravenously), rectally or vaginally or topically, for example, as a skin ointment or lotion. The PUFAs of the present invention may be administered alone or in combination with a pharmaceutically acceptable carrier or excipient. Where available, gelatin capsules are the preferred form of oral administration. Dietary supplementation as set forth above also can provide an oral route of administration. The unsaturated acids of the present invention may be administered in conjugated forms, or as salts, esters, amides or prodrugs of the fatty acids. Any pharmaceutically acceptable salt is encompassed by the present invention; especially preferred are the sodium, potassium or lithium salts. Also encompassed are the N-alkylpolyhydroxamine salts, such as N-methyl glucamine, found in PCT publication WO 96/33155. The preferred esters are the ethyl esters. As solid salts, the PUFAs also can be administered in tablet form. For intravenous administration, the PUFAs or derivatives thereof may be incorporated into commercial formulations such as Intralipids. The typical normal adult plasma fatty acid profile comprises 6.64 to 9.46% of ARA, 1.45 to 3.11% of DGLA, and 0.02 to 0.08% of GLA. These PUFAs or their metabolic precursors can be administered, either alone or in mixtures with other PUFAs, to achieve a normal fatty acid profile in a patient. Where desired, the individual components of formulations may be individually provided in kit form, for single or multiple use. A typical dosage of a particular fatty acid is from 0.1 mg to 20 g, or even 100 g daily, and is preferably from 10 mg to 1, 2, 5 or 10 g daily as required, or molar equivalent amounts of derivative forms thereof. Parenteral nutrition compositions comprising from about 2 to about 30 weight percent fatty acids calculated as triglycerides are encompassed by the present invention; preferred is a composition having from about 1 to about 25 weight percent of the total PUFA composition as GLA (USPN 5,196,198). Other vitamins, and particularly fat-soluble vitamins such as vitamin A, D, E and L-carnitine can optionally be included. Where desired, a preservative such as α tocopherol may be added, typically at about 0.1% by weight.
Suitable pharmaceutical compositions may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions and sterile powders for reconstitution into sterile injectible solutions or dispersions. Examples of suitable aqueous and non-aqeuous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propylleneglyol, polyethylenegycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ehyl oleate. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents, for example sugars, sodium chloride and the like. Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents. Suspensions in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances and the like. An especially preferred pharmaceutical composition contains diacetyltartaric acid esters of mono- and diglycerides dissolved in an aqueous medium or solvent. Diacetyltartaric acid esters of mono- and diglycerides have an HLB value of about 9-12 and are significantly more hydrophilic than existing antimicrobial lipids that have HLB values of 2-4. Those existing hydrophobic lipids cannot be formulated into aqueous compositions. As disclosed herein, those lipids can now be solubilized into aqueous media in combination with diacetyltartaric acid esters of mono-and diglycerides. In accordance with this embodiment, diacetyltartaric acid esters of mono- and diglycerides (e.g., DATEM-C12:0) is melted with other active antimicrobial lipids (e.g., 18:2 and 12:0 monoglycerides) and mixed to obtain a homogeneous mixture. Homogeneity allows for increased antimicrobial activity. The mixture can be completely dispersed in water. This is not possible without the addition of diacetyltartaric acid esters of mono- and diglycerides and premixing with other monoglycerides prior to introduction into water. The aqueous composition can then be admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants as may be required to form a spray or inhalant.
Treatment of Diseases and Disorders
The present invention also encompasses the treatment of numerous disorders with fatty acids. Supplementation with PUFAs of the present invention can be used to treat restenosis after angioplasty. Symptoms of inflammation, rheumatoid arthritis, and asthma and psoriasis can be treated with the PUFAs of the present invention. Evidence indicates that PUFAs may be involved in calcium metabolism, suggesting that PUFAs of the present invention may be used in the treatment or prevention of osteoporosis and of kidney or urinary tract stones.
The PUFAs of the present invention can be used in the treatment of cancer. Malignant cells have been shown to have altered fatty acid compositions; addition of fatty acids has been shown to slow their growth and cause cell death, and to increase their susceptibility to chemotherapeutic agents. GLA has been shown to cause reexpression on cancer cells of the E-cadherin cellular adhesion molecules, loss of which is associated with aggressive metastasis. Clinical testing of intravenous administration of the water soluble lithium salt of GLA to pancreatic cancer patients produced statistically significant increases in their survival. PUFA supplementation may also be useful for treating cachexia associated with cancer. The PUFAs of the present invention can also be used to treat diabetes (USPN 4,826,877; Horrobin et al, Am. J. Clin. Nutr. Vol. 57 (Suppl.), 732S- 737S). Altered fatty acid metabolism and composition has been demonstrated in diabetic animals. These alterations have been suggested to be involved in some of the long-term complications resulting from diabetes, including retinopathy, neuropathy, nephropathy and reproductive system damage. Primrose oil, which contains GLA, has been shown to prevent and reverse diabetic nerve damage.
The PUFAs of the present invention can be used to treat eczema, reduce blood pressure and improve math scores. Essential fatty acid deficiency has been suggested as being involved in eczema, and studies have shown beneficial effects on eczema from treatment with GLA. GLA has also been shown to reduce increases in blood pressure associated with stress, and to improve performance on arithmetic tests. GLA and DGLA have been shown to inhibit platelet aggregation, cause vasodilation, lower cholesterol levels and inhibit proliferation of vessel wall smooth muscle and fibrous tissue (Brenner et al., Adv. Exp. Med. Biol. Vol. 83, p. 85-101, 1976). Administration of GLA or DGLA, alone or in combination with EPA, has been shown to reduce or prevent gastro-intestinal bleeding and other side effects caused by non-steroidal anti- inflammatory drugs (USPN 4,666,701). GLA and DGLA have also been shown to prevent or treat endometriosis and premenstrual syndrome (USPN 4,758,592) and to treat myalgic encephalomyelitis and chronic fatigue after viral infections (USPN 5,116,871).
Further uses of the PUFAs of this invention include use in treatment of AIDS, multiple schlerosis, acute respiratory syndrome, hypertension and inflammatory skin disorders. The PUFAs of the inventions also can be used for formulas for general health as well as for geriatric treatments.
Veterinary Applications
It should be noted that the above-described pharmaceutical and nutritional compositions may be utilized in connection with animals, as well as humans, as animals experience many of the same needs and conditions as human. For example, the oil or acids of the present invention may be utilized in animal feed supplements.
The following examples are presented by way of illustration, not of limitation.
Examples
Example 1 Isolation of a Δ5-desaturase Nucleotide Sequence from Mortierella alpina
Example 2 Expression of M. alpina Δ5-desaturase Clones in Baker's Yeast
Example 3 Initial Optimization of Culture Conditions
Example 4 Distribution of PUFAs in Yeast Lipid Fractions
Example 5 Further Yeast Culture Optimization
Example 6 Expression of M. alpina Δ5 desaturase in insect cells
Example 7 Identification of Homologues to M. alpina Δ5 and Δ6 desaturases
Example 8 Identification of M. alpina Δ5 and Δ6 homologues in other PUFA-producing organisms
Example 9 Identification of M. alpina Δ5 and Δ6 homologues in other PUFA-producing organisms
Example 10 Human Desaturase Sequences
Example 11 Production of Oil in Microorganisms
Example 12 Further Processing of Oil Produced by Microorganisms
Example 13 Further Purification of Oil Produced by Microorganisms
Example 14 Manufacture of Transgenic Oil Nutritional Products
Example 15 Nutritional Compositions Example 1 Isolation of a Δ5-desaturase Nucleotide Sequence from Mortierella alpina
ortierella alpina produces arachidonic acid (ARA, 20:4) from the precursor 20:3 by a Δ5-desaturase. A nucleotide sequence encoding the Δ5- desaturase from Mortierella alpina was obtained through PCR amplification using M. alpina 1st strand cDNA and degenerate oligonucleotide primers corresponding to amino acid sequences conserved between Δ6-desaturases from Synechocystis and Spirulina. The procedure used was as follows:
Total RNA was isolated from a 3 day old PUFA-producing culture of Mortierella alpina using the protocol of Hoge et al. (1982) Experimental Mycology 6:225-232. The RNA was used to prepare double-stranded cDNA using BRL's lambda-ZipLox system, following the manufacturer's instructions. Several size fractions of the M. alpina cDNA were packaged separately to yield libraries with different average-sized inserts. The "full-length" library contains approximately 3 x 106 clones with an average insert size of 1.77 kb. The "sequencing-grade" library contains approximately 6 x 105 clones with an average insert size of 1.1 kb.
5μg of total RNA was reverse transcribed using BRL Superscript RTase and the primer TSyn (5'-CCAAGCTTCTGCAGGAGCTCTTTTTTT TTTTTTTT-3'), SEQ ID NO: 10. Degenerate oligonucleotides were designed to regions conserved between the two cyanobacterial Δ6-desaturase sequences. The specific primers used were D6DESAT-F3 (SEQ ID NO: 8) (5'- CUACUACUACUACAYCAYACOTAYACOAAYAT-3') and D6DESAT-R3 (SEQ ID NO:9) (5'-CAUCAUCAUCAUOGGRAAOARRTGRTG-3'), where Y=C+T, R=A+G, and O=I+C. PCR amplification was carried out in a 25μl volume containing: template derived from 40 ng total RNA, 2 pM each primer, 200 μM each deoxyribonucleotide triphosphate, 60 mM Tris-Cl, pH 8.5, 15 mM (NH4) SO4, 2 mM MgCl . Samples were subjected to an initial denaturation step of 95 degrees (all temperatures Celsius) for 5 minutes, then held at 72 degrees while 0.2 U of Taq polymerase were added. PCR thermocycling conditions were as follows: 94 degrees for 1 min., 45 degrees for 1.5 min., 72 degrees for 2 min. PCR was continued for 35 cycles. PCR using these primers on the M. alpina first-strand cDNA produced a 550 bp reaction product. Comparison of the deduced amino acid sequence of the M. alpina PCR fragment SEQ ID NO:3 revealed regions of homology with Δ6-desaturases (see Figure 5). However, there was only about 28% identity over the region compared.
The PCR product was used as a probe to isolate corresponding cDNA clones from a M. alpina library. The longest cDNA clone, Ma29, was designated pCGN5521 and has been completely sequenced on both strands. The cDNA is contained as a 1481 bp insert in the vector pZLl (Bethesda Research Laboratories) and, beginning with the first ATG, contains an open reading frame encoding 446 amino acids. The reading frame contains the sequence deduced from the PCR fragment. The sequence of the cDNA insert was found to contain regions of homology to Δ6-desaturases (see Figure 5). For example, three conserved "histidine boxes" (that have been observed in membrane-bound desaturases (Okuley et al, (1994) The Plant Cell 6:147-158)) were found to be present in the Mortierella sequence at amino acid positions 171-175, 207-212, and 387-391 (see Figure 3). However, the typical "HXXHH" amino acid motif for the third histidine box for the Mortierella desaturase was found to be QXXHH, SEQ ID NO: 11-12. Surprisingly, the amino-terminus of the encoded protein, showed significant homology to cytochrome b5 proteins. Thus, the Mortierella cDNA clone appears to represent a fusion between a cytochrome b5 and a fatty acid desaturase. Since cytochrome b5 is believed to function as the electron donor for membrane- bound desaturase enzymes, it is possible that the N-terminal cytochrome b5 domain of this desaturase protein is involved in its function. This may be advantageous when expressing the desaturase in heterologous systems for PUFA production. Example 2 Expression of M. alpina Desaturase Clones in Baker's Yeast
Yeast Transformation
Lithium acetate transformation of yeast was performed according to standard protocols (Methods in Enzymology, Vol. 194, p. 186-187, 1991).
Briefly, yeast were grown in YPD at 30°C. Cells were spun down, resuspended in TE, spun down again, resuspended in TE containing 100 mM lithium acetate, spun down again, and resuspended in TE/lithium acetate. The resuspended yeast were incubated at 30°C for 60 minutes with shaking. Carrier DNA was added, and the yeast were aliquoted into tubes. Transforming DNA was added, and the tubes were incubated for 30 min. at 30°C. PEG solution (35% (w/v) PEG 4000, 100 mM lithium acetate, TE pH7.5) was added followed by a 50 min. incubation at 30°C. A 5 min. heat shock at 42°C was performed, the cells were pelleted, washed with TE, pelleted again and resuspended in TE. The resuspended cells were then plated on selective media.
Desaturase Expression in Transformed Yeast
The cDNA clones from Mortierella alpina were screened for desaturase activity in baker's yeast. A canola Δ15-desaturase (obtained by PCR using 1st strand cDNA from Brassica napus cultivar 212/86 seeds using primers based on the published sequence (Arondel et al. Science 258: 1353-1355)) was used as a positive control. The Δ15-desaturase gene and the gene from cDNA clone Ma29 was inserted into the expression vector pYES2 (Invitrogen), resulting in plasmids pCGR-2 and pCGR-4, respectively. These plasmids were transfected into S. cerevisiae yeast strain 334 and expressed after induction with galactose and in the presence of substrates that allowed detection of specific desaturase activity. The control strain was S. cerevisiae strain 334 containing the unaltered pYES2 vector. The substrates used, the products produced and the indicated desaturase activity were: DGLA (conversion to ARA would indicate Δ5- desaturase activity), linolenic acid (conversion to GLA would indicate Δ6- desaturase activity; conversion to ALA would indicate Δ15-desaturase activity), oleic acid (an endogenous substrate made by S. cerevisiae, conversion to linolenic acid would indicate Δ12-desaturase activity, which S. cerevisiae lacks), or ARA (conversion to EPA would indicate Δ17-desaturase activity). The results are provided in Table 1 below.
Lipid Extraction
The lipid fractions were extracted as follows: Cultures were grown for 48-52 hours at 15°C. Cells were pelleted by centrifugation, washed once with sterile ddH20, and repelleted. Pellets were vortexed with methanol; chloroform was added along with tritridecanoin (as an internal standard). The mixtures were incubated for at least one hour at room temperature or at 4°C overnight. The chloroform layer was extracted and filtered through a Whatman filter with one gram of anhydrous sodium sulfate to remove particulates and residual water. The organic solvents were evaporated at 40°C under a stream of nitrogen. The extracted lipids were then derivatized to fatty acid methyl esters (FAME) for gas chromatography analysis (GC) by adding 2 ml of 0.5 N potassium hydroxide in methanol to a closed tube. The samples were heated to 95°C to 100°C for 30 minutes and cooled to room temperature. Approximately 2 ml of 14 % boron trifluoride in methanol was added and the heating repeated. After the extracted lipid mixture cooled, 2 ml of water and 1 ml of hexane were added to extract the FAME for analysis by GC. The percent conversion was calculated by dividing the product produced by the sum of (the product produced and the substrate added) and then multiplying by 100. To calculate the oleic acid percent conversion, as no substrate was added, the total linolenic acid produced was divided by the sum of (oleic acid and linolenic acid produced), then multiplying by 100. Table 1
M. alpina Desaturase Expression in Baker's Yeast
CLONE TYPE OF ENZYME % CONVERSION
ACTIVITY OF SUBSTRATE pCGR-2 Δ6 0 (18:2 to l8:3ω6)
(canola Δ15 Δ15 16.3 (18:2 to l8:3ω3) desaturase) Δ5 2.0 (20:3 to 20:4ω6)
Δ17 2.8 (20:4 to 20:5ω3)
Δ12 1.8 (18:l to l8:2ω6)
pCGR-4 Δ6 0
(M. alpina Δ15 0
Ma29) Δ5 15.3
Δ17 0.3
Δ12 3.3
The Δ15-desaturase control clone exhibited 16.3% conversion of the substrate. The pCGR-4 clone expressing the Ma29 cDNA converted 15.3% of the 20:3 substrate to 20:4ω6, indicating that the gene encodes a Δ5-desaturase. The background (non-specific conversion of substrate) was between 0-3% in these cases. We also found substrate inhibition of the activity by using different concentrations of the substrate. When substrate was added to 100 μM, the percent conversion to product dropped compared to when substrate was added to 25 μM (see below). Additionally, by varying the DGLA substrate concentrations, between about 5 μM to about 200 μM percent conversion of DGLA to ARA ranged from about 5% to 75% with the M. alpina Δ5- desaturase. These data show that desaturases with different substrate specificities can be expressed in a heterologous system and used to produce poly-unsaturated long chain fatty acids. Table 2 represents fatty acids of interest as a percent of the total lipid extracted from the yeast host S. cerevisiae 334 with the indicated plasmid. No glucose was present in the growth media. Affinity gas chromatography was used to separate the respective lipids. GC/MS was employed to verify the identity product(s). The expected product for the B. napus Δ15-desaturase, α- linolenic acid, was detected when its substrate, linolenic acid, was added exogenously to the induced yeast culture. This finding demonstrates that yeast expression of a desaturase gene can produce functional enzyme and detectable amounts of product under the current growth conditions. Both exogenously added substrates were taken up by yeast, although slightly less of the longer chain PUFA, dihomo-γ-linolenic acid (20:3), was incorporated into yeast than linolenic acid (18:2) when either was added in free form to the induced yeast cultures. Arachidonic acid was detected as a novel PUFA in yeast when dihomo-γ-linolenic acid was added as the substrate to S. cerevisiae 334 (pCGR- 4). This identifies pCGR-4 (MA29) as the Δ5-desaturase from M. alpina. Prior to this, no isolation and expression of a Δ5-desaturase from any source has been reported.
Table 2 Fatty Acid as a Percentage of Total Lipid Extracted from Yeast
I I
Figure imgf000059_0002
100 μM substrate added
* 18:1 is an endogenous fatty acid in yeast
Key To Tables
18: 1 =oleic acid
18:2 =linolenic acid α-18:3 =α-linolenic acid γ-18:3 =γ-linolenic acid
18:4 =stearidonic acid
20:3 =dihomo-γ-linolenic acid
20:4 =arachidonic acid
Figure imgf000059_0001
Example 3 Optimization of Culture Conditions
Table 3 A shows the effect of exogenous free fatty acid substrate concentration on yeast uptake and conversion to fatty acid product as a percentage of the total yeast lipid extracted. In all instances, low amounts of exogenous substrate (1-10 μM) resulted in low fatty acid substrate uptake and product formation. Between 25 and 50 μM concentration of free fatty acid in the growth and induction media gave the highest percentage of fatty acid product formed, while the 100 μM concentration and subsequent high uptake into yeast appeared to decrease or inhibit the desaturase activity. The feedback inhibition of high fatty acid substrate concentration was well illustrated when the percent conversion rates of the respective fatty acid substrates to their respective products were compared in Table 3B. In all cases, 100 μM substrate concentration in the growth media decreased the percent conversion to product. The effect of media composition was also evident when glucose was present in the growth media for the Δ5-desaturase, since the percent of substrate uptake was decreased at 25 μM (Table 3A). However, the percent conversion by Δ5- desaturase increased by 18% and the percent product formed remained the same in the presence of glucose in the growth media.
Table 3A
Effect of Added Substrate on the Percentage of Incorporated
Substrate and Product Formed in Yeast Extracts
Figure imgf000061_0001
Table 3B
Effect of Substrate Concentration in Media on the Percent Conversion of Fatty Acid Substrate to Product in Yeast Extracts
Figure imgf000061_0002
0 no glucose in media
+ Yeast peptone broth (YPD)
* 18:1 is an endogenous yeast lipid sub. is substrate concentration
ND (not done)
Table 4 shows the amount of fatty acid produced by a recombinant desaturase from induced yeast cultures when different amounts of free fatty acid substrate were used. Fatty acid weight was determined since the total amount of lipid varied dramatically when the growth conditions were changed, such as the presence of glucose in the yeast growth and induction media. To better determine the conditions when the recombinant desaturase would produce the most PUFA product, the quantity of individual fatty acids were examined. The absence of glucose reduced the amount of arachidonic acid produced by Δ5-desaturase by half. For Δ5-desaturase the amount of total yeast lipid was decreased by almost half in the absence of glucose.
Table 4 Fatty Acid Produced in μg from Yeast Extracts
Figure imgf000062_0001
0 no glucose in media sub. is substrate concentration ND (not done) * 18:1, the substrate, is an endogenous yeast lipid
Example 4 Distribution of PUFAs in Yeast Lipid Fractions
Table 5 illustrates the uptake of free fatty acids and their new products formed in yeast lipids as distributed in the major lipid fractions. A total lipid extract was prepared as described above. The lipid extract was separated on TLC plates, and the fractions were identified by comparison to standards. The bands were collected by scraping, and internal standards were added. The fractions were then saponified and methylated as above, and subjected to gas chromatography.
The gas chromatograph calculated the amount of fatty acid by comparison to a standard. It would appear that the substrates are accessible in the phospholipid form to the desaturases. Table 5 Fatty Acid Distribution in Various Yeast Lipid Fractions in μg
Figure imgf000063_0001
SC = S. cerevisiae (plasmid)
Example 5
Further Yeast Culture Optimization
The growth and induction conditions for optimal activities of desaturases in Saccharomyces cerevisiae were evaluated. Various culture conditions that were manipulated for optimal activity were: I) induction temperature, ii) concentration of inducer, iii) timing of substrate addition, iv) concentration of substance, v) sugar source, vi) growth phase at induction. These studies were done using Δ5- desaturase gene from Mortierella alpina (MA 29). In addition, the effect of changing host strain on expression of the Δ5-desaturase gene was also determined.
As described above, the best rate of conversion of substrate to ARA was observed at a substrate concentration of 1 μM, however, the percentage of ARA in the total fatty acids was highest at 25 μM substrate concentration. To determine if the substrate needed to be modified to a readily available form before it could be utilized by the desaturase, the substrate was added either 15 hours before induction or concomitant with inducer addition (indicated as after, in Figure 6A). As it can be seen in Figure 6A, addition of substrate before induction did not have a significant effect on the activity of Δ5-desaturase. In fact, addition of substrate along with the inducer was slightly better for expression activity of Δ5-desaturase, as ARA levels in the total fatty acids were higher. However, the rate of conversion of substrate to product was slightly lower. The effect of inducer concentration of expression/activity of Mortierella Δ5-desaturase was examined by inducing SC334/pCGR5 with 0.5 or 2% (w/v) of galactose. As shown in Figures 7A and 7B, expression of Δ5-desaturase was higher when induced with 0.5% galactose. Furthermore, rate of conversion of substrate to product was also better when SC334/pCGR5 was induced with 0.5% galactose vs 2% galactose.
To determine the effect of temperature on Δ5-desaturase activity, the SC334 host strain, transformed with pCGR5 (SC334/pCGR5) was grown and induced at 15° C, 25°C, 30°C and 37°C. The quantity of ARA (20:4n6) produced in SC334/pCGR5 cultures, supplemental with substrate 20:3n6, was measured by fatty acid analysis. Figure 8A depicts the quantity of 20:3n6 and 20:4n6, expressed as percentage of total fatty acids. Figure 8B depicts the rate of conversion of substrate to product. Growth and induction of SC334/pCGR5 at 25°C, was the best for the expression of Δ5-desaturase as evidenced by the highest levels of arachidonic acid in the total fatty acids. Additionally the highest rate of conversion of substrate to product also occurred at 25°C. Growth and induction at 15°C gave the lowest expression of ARA, whereas at 37°C gave the lowest conversion of substrate to product.
The effect of yeast strain on expression of the Δ5-desaturase gene was studied in 5 different host strains; LNVSC 1 , LNVSC2, YTC34, YTC41 , and SC334, at 15°C and 30°C. At 15°C, SC334 has the highest percentage of ARA in total fatty acids, suggesting higher activity of Δ5-desaturase in SC334. The rate of conversion of substrate to product, however is lowest in SC334 and highest in LNVSC 1 (Fig. 9A and B). At 30°C, the highest percentage of product (ARA) in total fatty acids was observed in LNVSC2, although the rate of conversion of substrate to product in LNVSC2 was slightly lower than LNVSCl (Fig. 10A and B).
ARA, the product of Δ5 -desaturase, is stored in the phospholipid faction (Example 4). Therefore the quantity of ARA produced in yeast is limited by the amount that can be stored in the phospholipid fraction. If ARA could also be stored in other fractions such as the triglyceride fraction, the quantity of ARA produced in yeast might be increased. To test this hypothesis, the Δ5-desaturase gene was expressed in the yeast host strain DBY746 (obtained from the Yeast Genetic Stock Centre, 1021 Donner Laboratory, Berkeley, CA 94720. The genotype of strain DBY746 is Matα, his3-Δl, leu2-3, leu2-l 12, ura3-32, tφl-289, gal). The DBY746 yeast strain has an endogenous gene for choline transferase. The presence of this enzyme might enable the DB Y746 strain to convert excess phospholipids into triglycerides fraction. Results in Fig. 11 show no increase in the conversion of substrate to product as compared to SC334, which does not have the gene for choline transferase.
To study the effect of media on expression of Δ5-desaturase, pCGR4/SC334 was grown in four different media at two different temperatures
(15°C and 30°) and in two different host strains (SC334 and LNVSC 1). The composition of the media was as follows:
Media A: mm-Ura, + 2% galactose + 2% glucose.
Media B: mm-Ura, + 20% galactose + 2% Glucose + 1M sorbitol (pH5.8) Media C: mm-Ura, + 2% galactose + 2% raffinose
Media D: mm-Ura, + 2% galactose +2% raffinose + 1M sorbitol (pH5.8) mm=minimal media
Results show that the highest conversion rate of substrate to product at 15°C in SC334 was observed in media A. The highest conversion rate overall for Δ5-desaturase in SC334 was at 30° in media D. The highest conversion rate of Δ5- desaturase in LNVSC 1 was also at 30° in media D (Figures 12A and 12B).
These data show that a DNA encoding a desaturase that can convert DGLA to ARA can be isolated from Mortierella alpina and can be expressed in a heterologous system and used to produce poly-unsaturated long chain fatty acids. Exemplified is the production of ARA from the precursor DGLA by expression of a Δ5-desaturase in yeast. Example 6
Expression Of M. alpina Δ5 Desaturases In Insect Cells
Insect cells were used as another eukaryotic host for expression of the M. alpina D5-desaturase. The baculovirus expression system involves the use of insect cells to express a gene, in this case the M. alpina D5-desaturase, which has been cloned into a baculovirus expression vector. Insect cells are known to have no endogenous PUFA desaturase activities. Therefore, this system is suitable for expression and characterization of the recombinant desaturases.
The fragment containing the D5-desaturase gene (pCGR4, see Example 2) was PCR amplified using Expand High Fidelity PCR System (Boehringer
Mannheim, Coφ., Indianapolis, LN) and a set of primers containing appropriate restriction sites. The upstream primer designated RO651 (5'- ATACCGGAATTCGCCGCCACCATGGGAACGGACCAAGGAAAAAC), SEQ ID NO: 35 corresponded to the sense strand of D5 cDNA and contained an EcoRI site 5' upstream of the ATG. The downstream primer RO652 (5'-
TATCCGCTCGAGCTACTCTTCCTTGGGACGGAG), SEQ ID NO: 36 corresponded to the antisense strand at the 3' end of the D5 cDNA, and included an Xhol site immediately downstream of the translational termination codon. The PCR reaction, in a final volume of 100 μl, was carried out for 30 cycles in temperature conditions of 45 seconds at 94° C, 45 seconds at 55 °C and 2 min at
72 °C. The D5 PCR amplified product was analyzed by agarose-gel electrophoresis, gel purified, digested with EcoRI and Xhol, and then ligated into pFastBacl baculovirus donor plasmid (Gibco-BRL, Gaithersburg, MD) which was restricted with the same enzymes. The respective baculovirus clone was designated as pJPB5 for the D5-desaturase. This pFastBacl vector contains an expression cassette which has a polyhedrin promoter, a SV40 polyadenylation signal, and a gentamycin resistance marker.
The initial transformation was done in XL1 blue cells (Invitrogen, Carlsbad, CA). Positive clones were then transformed into E. coli DHlOBac (Gibco-BRL, Gaithersburg, MD) which contains the baculovirus genome. The positive clones were selected by blue white screening in which white colonies contain the recombinant bacmid. White colonies were then selected for bacmid DNA isolation. DNA was isolated using a Qiagen plasmid isolation kit (Qiagen Inc., Valencia, CA), specific for DNA over 135 kb long. The recombinant DNA bacmid was analyzed on a 0.6% agarose gel to confirm the presence of the high molecular weight DNA. PCR analysis, using pUC/M 13 primers (forward 5'-
TGTAAAACGACGGCCAGT SEQ ID NO: 37 and reverse 5'- GAAACAGCTATGACCATG) SEQ ID NO: 38 was also performed to confirm the correct insert size for the desaturase cDNA within the bacmid.
The Sf9 insect cells (Spodoptera frugiperda) were used for the recombinant bacmid DNA transfection. These cells were grown in serum free media Sf900
(Gibco BRL, Gaithersburg, MD). Transfection was carried out according to the CellFECTLN protocol (Gibco-BRL, Gaithersburg, MD). The recombinant virus was recovered by collecting the supernatant at 72 hours post- transfection. A Plaque assay was performed on the supernatant to determine the titer of recovered recombinant virion particles. A recombinant viral stock was made for the expression studies. All infections with the recombinant virus were done during the mid-logarithmic growth phase of the Sf9's and infected at 5 MOI (Mutiplicity of Infection). To analyze the activity of the expressed D5-desaturase gene, the Sf9 cells were plated at a concentration of 1x106 cells/well in a 6- well tissue culture plate and infected with lOOul of the virus stock (approximately 5 MOI). The substrate, dihomo-gamma-linolenic acid (DGLA, C20:3n-6) was supplemented at the time of infection, at a concentration of 25 μM. A mock infected Sf9, as well as cells infected with a recombinant virus containing the GusA reporter gene, were used as negative controls in each experiment. The medium was collected 48 hours post infection and saved. The cells were collected and submitted for lipid analysis.
For fatty acid analysis, cell pellets were vortexed with 6 ml of methanol, followed by the addition of 12 ml of chloroform and tridecanoin (as internal standard). The mixtures were incubated for at least one hour at room temperature or at 4°C overnight. The chloroform layer was extracted and filtered through a Whatman filter with one gram of anhydrous sodium sulfate to remove particulates and residual water. The organic solvents were evaporated at 400 °C under a stream of nitrogen. The extracted lipids were derivatized to fatty acid methyl esters (FAME) for gas chromatography analysis (GC) by adding 2 ml of 0.5N potassium hydroxide in methanol to a closed tube. The samples were heated at 95 to 100°C for 30 minutes and cooled to room temperature. Approximately 2 ml of the 14% boron triflouride in methanol was added and the heating repeated. After the extracted lipid mixture cooled, 2 ml of water and 1 ml of hexane were added to extract the FAME for GC analysis. The percent conversion was calculated by dividing the product produced by the sum of (the product produced and the substrate) and then multiplying by 100.
The fatty acid synthesis in insect cells infected with recombinant virus containing D5 cDNA is summarized in Table 6. The conversion of the added substrate, DGLA, to Arachidonic acid (AA, 20:4n-6) was monitored. AA, and other fatty acids containing longer carbon chains, were detected in the presence of the recombinant fungal D5-desaturase enzyme. The quantity of arachidonic acid (AA, 20:4n-6) produced by the D5-desaturase was 1.4% of the total fatty acid versus the control which expressed only 0.175% . This resulted in a 23% conversion of DGLA to AA.
These data indicate that the M. alpina D5-desaturase can be expressed in another eukaryotic host (insect cells) in a biologically active form as demonstrated by the production of AA as well as the accumulation of fatty acids with longer carbon chains.
Table 6
Figure imgf000068_0001
Example 7
Identification of Homologues to M. alpina Δ5 and Δ6 desaturases
A nucleic acid sequence that encodes a putative Δ5 desaturase was identified through a TBLASTN search of the est databases through NCBI using amino acids 100-446 of Ma29 as a query. The truncated portion of the Ma29 sequence was used to avoid picking up homologies based on the cytochrome b5 portion at the N-terminus of the desaturase. The deduced amino acid sequence of an est from Dictyostelium discoideum (accession # C25549) shows very significant homology to Ma29 and lesser, but still significant homology to Ma524. The DNA sequence is presented as SEQ ID NO: 13. The amino acid sequence is presented as
SEQ LD NO: 14.
Example 8
Identification of M. alpina Δ5 and Δ6 homologues in other PUFA-producing organisms
To look for desaturases involved in PUFA production, a cDNA library was constructed from total RNA isolated from Phaeodactylum tricornutum. A plasmid-based cDNA library was constructed in pSPORTl (GIBCO-BRL) following manufacturer's instructions using a commercially available kit (GLBCO-BRL). Random cDNA clones were sequenced and nucleic acid sequences that encode putative Δ5 or Δ6 desaturases were identified through
BLAST search of the databases and comparison to Ma29 and Ma524 sequences.
One clone was identified from the Phaeodactylum library with homology to Ma29 and Ma524; it is called 144-011-B12. The DNA sequence is presented as SEQ LD NO: 15. The amino acid sequence is presented as SEQ ID NO: 16. Example 9
Identification of M. alpina Δ5 and Δ6 homologues in other PUFA-producing organisms
To look for desaturases involved in PUFA production, a cDNA library was constructed from total RNA isolated from Schizochytrium species. A plasmid-based cDNA library was constructed in pSPORTl (GLBCO-BRL) following manufacturer's instructions using a commercially available kit (GLBCO-BRL). Random cDNA clones were sequenced and nucleic acid sequences that encode putative Δ5 or Δ6 desaturases were identified through BLAST search of the databases and comparison to Ma29 and Ma524 sequences.
One clone was identified from the Schizochytrium library with homology to Ma29 and Ma524; it is called 81-23-C7. This clone contains a ~1 kb insert. Partial sequence was obtained from each end of the clone using the universal forward and reverse sequencing primers. The DNA sequence from the forward primer is presented as SEQ ID NO: 17. The peptide sequence is presented as SEQ ID
NO: 18. The DNA sequence from the reverse primer is presented as SEQ ID NO: 19. The amino acid sequence from the reverse primer is presented as SEQ ID NO:20.
Example 10
Human Desaturase Gene Sequences
Human desaturase gene sequences potentially involved in long chain polyunsaturated fatty acid biosynthesis were isolated based on homology between the human cDNA sequences and Mortierella alpina desaturase gene sequences. The three conserved "histidine boxes" known to be conserved among membrane- bound desaturases were found. As with some other membrane-bound desaturases the final HXXHH histidine box motif was found to be QXXHH. The amino acid sequence of the putative human desaturases exhibited homology to M. alpina Δ5, Δ6, Δ9, and Δ12 desaturases. The M. alpina Δ5 desaturase and Δ6 desaturase cDNA sequences were used to search the LifeSeq database of Incyte Pharmaceuticals, Inc., Palo Alto, California 94304. The Δ5 desaturase sequence was divided into fragments; 1) amino acid no. 1-150, 2) amino acid no. 151-300, and 3) amino acid no. 301-446. The Δ6 desaturase sequence was divided into three fragments; 1) amino acid no. 1-
150, 2) amino acid no. 151-300, and 3) amino acid no. 301-457. These polypeptide fragments were searched against the database using the "tblastn" algorithm. This alogarithm compares a protein query sequence against a nucleotide sequence database dynamically translated in all six reading frames (both strands).
The polypeptide fragments 2 and 3 of M. alpina Δ5 and Δ6 have homologies with the ClonelD sequences as outlined in Table 6. The ClonelD represents an individual sequence from the Incyte LifeSeq database. After the "tblastn" results have been reviewed, Clone Information was searched with the default settings of Stringency of >=50, and Productscore <=100 for different
ClonelD numbers. The Clone Information Results displayed the information including the ClusterlD, ClonelD, Library, HitID, Hit Description. When selected, the ClusterlD number displayed the clone information of all the clones that belong in that ClusterlD. The Assemble command assembles all of the ClonelD which comprise the ClusterlD. The following default settings were used for GCG
(Genetics Computer Group, University of Wisconsin Biotechnology Center, Madison, Wisconsin 53705) Assembly:
Word Size: 7 Minimum Overlap: 14
Stringency: 0.8
Minimum Identity: 14
Maximum Gap: 10
Gap Weight: 8 Length Weight: 2 GCG Assembly Results displayed the contigs generated on the basis of sequence information within the ClonelD. A contig is an alignment of DNA sequences based on areas of homology among these sequences. A new sequence (consensus sequence) was generated based on the aligned DNA sequences within a contig. The contig containing the ClonelD was identified, and the ambiguous sites of the consensus sequence was edited based on the alignment of the ClonelDs (see SEQ LD NO:21 - SEQ ID NO:25) to generate the best possible sequence. The procedure was repeated for all six ClonelD listed in Table 6. This produced five unique contigs. The edited consensus sequences of the 5 contigs were imported into the Sequencher software program (Gene Codes Coφoration, Ann Arbor, Michigan 48 105). These consensus sequences were assembled. The contig 2511785 overlaps with contig 3506132, and this new contig was called 2535 (SEQ ID NO:27). The contigs from the Sequencher program were copied into the Sequence Analysis software package of GCG.
Each contig was translated in all six reading frames into protein sequences. The M. alpina Δ5 (MA29) and Δ6 (MA524) sequences were compared with each of the translated contigs using the FastA search (a Pearson and Lipman search for similarity between a query sequence and a group of sequences of the same type (nucleic acid or protein)). Homology among these sequences suggest the open reading frames of each contig. The homology among the M. alpina Δ5 and Δ6 to contigs 2535 and 3854933 were utilized to create the final contig called 253538a. Figure 13 is the FastA match of the final contig 253538a and MA29, and Figure 14 is the FastA match of the final contig 253538a and MA524. The DNA sequences for the various contigs are presented in SEQ ID NO:21 -SEQ ID NO:27. The various peptide sequences are shown in SEQ ID NO:28 - SEQ ID NO:34.
Although the open reading frame was generated by merging the two contigs, the contig 2535 shows that there is a unique sequence in the beginning of this contig which does not match with the contig 3854933. Therefore, it is possible that these contigs were generated from independent desaturase like human genes. The contig 253538a contains an open reading frame encoding 432 amino acids. It starts with Gin (CAG) and ends with the stop codon (TGA). The contig 253538a aligns with both M. alpina Δ5 and Δ6 sequences, suggesting that it could be either of the desaturases, as well as other known desaturases which share homology with each other. The individual contigs listed in Table 6, as well as the intermediate contig 2535 and the final contig 253538a can be utilized to isolate the complete genes for human desaturases.
Uses of the human desaturases
These human sequences can be expressed in yeast and plants utilizing the procedures described in the preceding examples. For expression in mammalian cells and transgenic animals, these genes may provide superior codon bias. These human sequences can also be used to identify related desaturase sequences.
Table 7
Figure imgf000073_0001
Example 10
Production of Oil in Microorganisms
The sequences presented in the Sequence Listing including sequences that are homologous to these sequences as well as those sequences that are related to these sequences may be cloned into an appropriate vector using procedures described herein and detailed in the previous examples. Such host cells can be utilized for the production of lipids and/or fats.
Extraction of lipids or fats from host cells follows the general procedure described by Folch, et al., J.Biol. Chem. 226: 497 1957 which is hereby incoφorated by reference. Host cells are grown under appropriate conditions and harvested. Harvested cells are homogenized mechanically with 20ml/g of a mixture of chloroform-methanol, 2:1 (v/v). In order to minimize oxidation, and anti-oxidant is added to the extraction solvent. If the oil is to be utilized for human consumption, vitamin E (α-tocopherol) is utilized as the anti-oxidant. After extraction, the solvent containing the lipid extract is washed with 0.2 volume of
0.58% NaCl. The mixture is thoroughly mixed and then transferred to a separating funnel. The mixed material is allowed to settle and two phases are separated out on standing. The bottom phase is collected and the solvent removed under vacuum. The residue contains the total tissue lipids.
Yeast Strains Rich in Lipids
Under some circumstances, vectors will be transformed into yeast strains rich in lipids. In these strains, a high percentage of the cell lipids is often stored in fat droplets containing mostly the triglycerides. For these cells, simply breaking the cell wall by mechanical, pressure or enzymatic means will release the fat droplet. Once released, the fat is extracted with hexane for further processing.
Example 12
Further Processing of Oil Produced by Microorganisms Further processing of oil produced by microorganisms is necessary to produce an edible food product. The refining process includes the following four steps.
1. Degumming: Degumming is utilized to remove phosphatides co-extracted with the oil, which tend to separate from the oil as a sludge during storage. Two steps are utilized: (1) phosphatides are precipitated with water and then (2) with a mild acid. The particles are removed by centrifugation. 2. Alkali Refining: This step is to utilized to further reduce the phosphatide content and also the free fatty acid content of the oil. In this step, the oil is first contacted with small volume of concentrated phosphoric acid in a mixer to precipitate phosphatides. The acidified mixture is then contacted with an aqueous solution of sodium hydroxide to neutralize the free fatty acids as well as any excess phosphoric acid to form a soapy phase. The soap is removed by centrifugation.
3. Adsorptive Bleaching: After the alkali-refining step, the crude oil often contains traces of soap and chlorophylloid compounds. The later gives an undesirable green color to the oil and should be removed. An acid-catalyzed clay or active carbon is utilized to remove these compounds.
4. Deodorization: The final refining step is deodorization. Deodorization is utilized to remove compounds from the oil that impart undesirable odors and tastes typical of the host organism. The step involves steam distillation of the odor and flavor compounds and other volatile compounds such as free fatty acids from the oil. The oil is heated to 225-260°C under very low pressure to exclude air and the volatile componds are removed. Deodorization can remove tocopherols to some extent. As the transgenic oil is more unsaturated than non-transgenic oil, additional amount of antioxidant(s) may be supplemented to protect the oil from oxidation.
Example 13
Further Purification of Oil Produced by Microorganisms
Under certain circumstances, further purification and enriching of long- chain polyunsaturated fatty acids from transgenic microorganisms is needed. Such further processing steps include the following:
1. Fractionation: Oils are mixtures of tri glycerides with different fatty acid compositions. Based on their different melting points, the triglycerides may be separated into different portions. Thermo-mechanical separation processes include distillation and crystallization. Distillation is generally commercially unsuitable, because the triglyceride mixtures have low vapor pressures and are unstable at high temperature. Crystallization (winterization) uses low temperature to separate solid triglyceride fraction from the liquid fraction. The liquid fraction is usually more unsaturated than the solid fraction. This method is a mild procedure especially suitable for triglyceride containing the polyunsaturated fatty acids.
2. Urea fractionation: Saturated fatty acids generally more readily form stable complexes than do unsaturated fatty acids with urea. The procedure can be used to enrich polyunsaturated fatty acids.
3. HPLC separation: HPLC using a reverse phase column can separate triglyceride molecules according to combined chain length of the fatty acid residues as well as the degree of unsaturation. Using this method, the highly unsaturated triglyceride molecules are eluted out the column for separation.
4. Supercritical fluid chromatography (SFC) or supercritical fluid extraction (SFC): SFC is a method whereby a highly compressed gas at a temperature and pressure above its critical temperature and pressure as a supercritical fluid is used to elute analytes from a chromatographic column. Triglycerides are separated by
SFC according to the combined chain length of the fatty acid residues using columns coated with relatively non-polar stationary phase, or according to the degree of unsaturation by using a more polar stationary phase. Generally, the triglyceride molecules are separated (1) according to their carbon numbers and (2) according to unsaturation within each carbon number group. In order words, the most unsaturated molecules have the strongest retention to the stationary phase and are eluted out the column last.
Example 14
Manufacture of Transgenic Oil Nutritional Products Once purified, transgenic oil is incoφorated into various food products. The incoφoration of transgenic oil into food products involves the following steps: (1) Preparation of slurry mix; (2) blending and (3) standardization:
I. Preparation of slurry mix: Basically, three different slurries are prepared before the final blending.
A. Protein-in-fat slurry (PIF)
Add the indicated amounts of oil blend (containing the transgenic canola oil and other oils at a designated ratio) to a kettle and heat at 120-140°F under moderate agitation. This is followed by the addition of DEK Premix, vitamin A, and soy lecithin, and Milei 75L WPC. Maintain the PLF at 120-
140°F under moderate agitation until use.
B. Carbohydrate/mineral slurry (CHO/MIN)
Heat the required amount of water to 140-160°F with high agitation. Add in order the indicated amounts of TM premix, Gum Arabic, and Fibrim 300, respectively. Allow each addition to be completely dispersed under high agitation before the next ingredient is added.
Add in order the indicated amounts of different mineral salts, dry blend of
Gellan Gum and sucrose, and fructooligosaccharides and maltrins. Allow slurry to mix under high agitation until dispersed completely. Maintain the
CHO/MLN slurry at 140-160°F under moderate agitation until use.
C. Protein-in-water slurry (PIW)
Add the indicated amount of water to a kettle and heat to 140-160°F. Add the Alanates, mix under high agitation until protein is completely dispersed, then slow the agitation to moderate speed. Maintain PIW under moderate agitation at 130-150°F for at least half hour before blending.
II. Blending: Weigh the indicated amount of PLF slurry and add to the PIW slurry, and mix under moderate agitation for 5 min. Add the CHO/MLN to the blend, and adjust to the designated pH value with IN KOH. Thereafter, deaerate the mix by vacuum, heat the mixture to 160-180°F, and emulsify mix at 900-1100 psig in a homogenizer. The mix goes through the UHT treatment, homogenized and pass the mix through a holding tube, and then cool mix to 34-45°F and store until standardization.
III. Standardization:
Add indicated amount water, vitamin solution, flavor solution, and color solution to the batch. Allow to mix thoroughly. Transfer into can, sterilize and store until use.
Example 15
Nutritional Compositions
The PUFAs of the previous examples can be utilized in various nutritional supplements, infant formulations, nutritional substitutes and other nutrition solutions. I. INFANT FORMULATIONS
A. Isomil® Soy Formula with Iron.
Usage: As a beverage for infants, children and adults with an allergy or sensitivity to cow's milk. A feeding for patients with disorders for which lactose should be avoided: lactase deficiency, lactose intolerance and galactosemia.
Features:
• Soy protein isolate to avoid symptoms of cow's-milk-protein allergy or sensitivity
• Lactose-free formulation to avoid lactose-associated diarrhea • Low osmolaity (240 mOsm/kg water) to reduce risk of osmotic diarrhea.
• Dual carbohydrates (corn syrup and sucrose) designed to enhance carbohydrate absoφtion and reduce the risk of exceeding the absoφtive capacity of the damaged gut. • 1.8 mg of Iron (as ferrous sulfate) per 100 Calories to help prevent iron deficiency.
• Recommended levels of vitamins and minerals.
• Vegetable oils to provide recommended levels of essential fatty acids.
• Milk-white color, milk-like consistency and pleasant aroma. Ingredients: (Pareve) 85% water, 4.9% corn syrup, 2.6% sugar (sucrose),
2.1% soy oil, 1.9% soy protein isolate, 1.4% coconut oil, 0.15% calcium citrate, 0.11 % calcium phosphate tribasic, potassium citrate, potassium phosphate monobasic, potassium chloride, mono- and disglycerides, soy lecithin, carrageenan, ascorbic acid, L-methionine, magnesium chloride, potassium phosphate dibasic, sodium chloride, choline chloride, taurine, ferrous sulfate, m- inositol, alpha-tocopheryl acetate, zinc sulfate, L-carnitine, niacinamide, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, potassium iodide, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin B. Isomil® DF Soy Formula For Diarrhea.
Usage: As a short-term feeding for the dietary management of diarrhea in infants and toddlers.
Features: • First infant formula to contain added dietary fiber from soy fiber specifically for diarrhea management.
• Clinically shown to reduce the duration of loose, watery stools during mild to severe diarrhea in infants.
• Nutritionally complete to meet the nutritional needs of the infant. • Soy protein isolate with added L-methionine meets or exceeds an infant's requirement for all essential amino acids.
• Lactose-free formulation to avoid lactose-associated diarrhea.
• Low osmolality (240 mOsm/kg water) to reduce the risk of osmotic diarrhea. • Dual carbohydrates (corn syrup and sucrose) designed to enhance carbohydrate absoφtion and reduce the risk of exceeding the absoφtive capacity of the damaged gut.
• Meets or exceeds the vitamin and mineral levels recommended by the Committee on Nutrition of the American Academy of Pediatrics and required by the Infant Formula Act.
• 1.8 mg of iron (as ferrous sulfate) per 100 Calories to help prevent iron deficiency.
• Vegetable oils to provide recommended levels of essential fatty acids.
Ingredients: (Pareve) 86% water, 4.8% corn syrup, 2.5% sugar (sucrose), 2.1 % soy oil, 2.0% soy protein isolate, 1.4% coconut oil, 0.77% soy fiber, 0.12% calcium citrate, 0.11 % calcium phosphate tribasic, 0.10% potassium citrate, potassium chloride, potassium phosphate monobasic, mono- and disglycerides, soy lecithin, carrageenan, magnesium chloride, ascorbic acid, L-methionine, potassium phosphate dibasic, sodium chloride, choline chloride, taurine, ferrous sulfate, m- inositol, alpha-tocopheryl acetate, zinc sulfate, L-carnitine, niacinamide, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, potassium iodide, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin
C. Isomil® SF Sucrose-Free Soy Formula With Iron.
Usage: As a beverage for infants, children and adults with an allergy or sensitivity to cow's-milk protein or an intolerance to sucrose. A feeding for patients with disorders for which lactose and sucrose should be avoided. Features:
• Soy protein isolate to avoid symptoms of cow's-milk-protein allergy or sensitivity.
• Lactose-free formulation to avoid lactose-associated diarrhea (carbohydrate source is Polycose® Glucose Polymers). • Sucrose free for the patient who cannot tolerate sucrose.
• Low osmolality (180 mOsm/kg water) to reduce risk of osmotic diarrhea.
• 1.8 mg of iron (as ferrous sulfate) per 100 Calories to help prevent iron deficiency. • Recommended levels of vitamins and minerals.
• Vegetable oils to provide recommended levels of essential fatty acids.
• Milk-white color, milk-like consistency and pleasant aroma.
Ingredients: (Pareve) 75% water, 11.8% hydrolized cornstarch, 4.1% soy oil, 4.1% soy protein isolate, 2.8% coconut oil, 1.0% modified cornstarch, 0.38% calcium phosphate tribasic, 0.17% potassium citrate, 0.13% potassium chloride, mono- and disglycerides, soy lecithin, magnesium chloride, abscorbic acid, L- methionine, calcium carbonate, sodium chloride, choline chloride, carrageenan, taurine, ferrous sulfate, m-inositol, alpha-tocopheryl acetate, zinc sulfate, L- carnitine, niacinamide, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, potassium iodide, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin.
D. Isomil® 20 Soy Formula With Iron Ready To Feed, 20 Cal/fl oz.
Usage: When a soy feeding is desired.
Ingredients: (Pareve) 85% water, 4.9% corn syrup, 2.6% sugar (sucrose), 2.1% soy oil, 1.9% soy protein isolate, 1.4% coconut oil, 0.15% calcium citrate, 0.11% calcium phosphate tribasic, potassium citrate, potassium phosphate monobasic, potassium chloride, mono- and disglycerides, soy lecithin, carrageenan, abscorbic acid, L-methionine, magnesium chloride, potassium phosphate dibasic, sodium chloride, choline chloride, taurine, ferrous sulfate, m- inositol, alpha-tocopheryl acetate, zinc sulfate, L-carnitine, niacinamide, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, potassium iodide, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin.
E. Similac® Infant Formula
Usage: When an infant formula is needed: if the decision is made to discontinue breastfeeding before age 1 year, if a supplement to breastfeeding is needed or as a routine feeding if breastfeeding is not adopted.
Features:
• Protein of appropriate quality and quantity for good growth; heat- denatured, which reduces the risk of milk-associated enteric blood loss.
• Fat from a blend of vegetable oils (doubly homogenized), providing essential linoleic acid that is easily absorbed.
• Carbohydrate as lactose in proportion similar to that of human milk.
• Low renal solute load to minimize stress on developing organs.
• Powder, Concentrated Liquid and Ready To Feed forms. Ingredients: Water, nonfat milk, lactose, soy oil, coconut oil, mono- and diglycerides, soy lecithin, abscorbic acid, carrageenan, choline chloride, taurine, m-inositol, alpha-tocopheryl acetate, zinc sulfate, niacinamid, ferrous sulfate, calcium pantothenate, cupric sulfate, vitamin A palmitate, thiamine chloride hydrochloride, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin.
F. Similac® NeoCare Premature Infant Formula With Iron
Usage: For premature infants' special nutritional needs after hospital discharge. Similac NeoCare is a nutritionally complete formula developed to provide premature infants with extra calories, protein, vitamins and minerals needed to promote catch-up growth and support development.
Features:
• Reduces the need for caloric and vitamin supplementation. More calories (22 Cal/fl oz) then standard term formulas (20 Cal/fl oz). • Highly absorbed fat blend, with medium-chain tri glycerides (MCT oil) to help meet the special digestive needs of premature infants.
• Higher levels of protein, vitamins and minerals per 100 Calories to extend the nutritional support initiated in-hospital.
• More calcium and phosphorus for improved bone mineralization. Ingredients: Corn syrup solids, nonfat milk, lactose, whey protein concentrate, soy oil, high-oleic safflower oil, fractionated coconut oil (medium- chain triglycerides), coconut oil, potassium citrate, calcium phosphate tribasic, calcium carbonate, ascorbic acid, magnesium chloride, potassium chloride, sodium chloride, taurine, ferrous sulfate, m-inositol, choline chloride, ascorbyl palmitate, L-carnitine, alpha-tocopheryl acetate, zinc sulfate, niacinamide, mixed tocopherols, sodium citrate, calcium pantothenate, cupric sulfate, thiamine chloride hydrochloride, vitamin A palmitate, beta carotene, riboflavin, pyridoxine hydrochloride, folic acid, manganese sulfate, phylloquinone, biotin, sodium selenite, vitamin D3 and cyanocobalamin. G. Similac Natural Care Low-Iron Human Milk Fortifier Ready To Use, 24 Cal/fl oz.
Usage: Designed to be mixed with human milk or to be fed alternatively with human milk to low-birth- weight infants. Ingredients: Water, nonfat milk, hydrolyzed cornstarch, lactose, fractionated coconut oil (medium-chain triglycerides), whey protein concentrate, soil oil, coconut oil, calcium phosphate tribasic, potassium citrate, magnesium chloride, sodium citrate, ascorbic acid, calcium carbonate, mono-and diglycerides, soy lecithin, carrageenan, choline chloride, m-inositol, taurine, niacinamide, L- carnitine, alpha tocopheryl acetate, zinc sulfate, potassium chloride, calcium pantothenate, ferrous sulfate, cupric sulfate, riboflavin, vitamin A palmitate, thiamine chloride hydrochloride, pyridoxine hydrochloride, biotin, folic acid, manganese sulfate, phylloquinone, vitamin D3j sodium selenite and cyanocobalamin. Various PUFAs of this invention can be substituted and/or added to the infant formulae described above and to other infant formulae known to those in the art..
II. NUTRITIONAL FORMULATIONS
A. ENSURE® Usage: ENSURE is a low-residue liquid food designed primarily as an oral nutritional supplement to be used with or between meals or, in appropriate amounts, as a meal replacement. ENSURE is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets. Although it is primarily an oral supplement, it can be fed by tube. Patient Conditions:
• For patients on modified diets
• For elderly patients at nutrition risk
• For patients with involuntary weight loss
• For patients recovering from illness or surgery • For patients who need a low-residue diet
Ingredients:
Water, Sugar (Sucrose), Maltodextrin (Corn), Calcium and Sodium Caseinates, High-Oleic Safflower Oil, Soy Protein Isolate, Soy Oil, Canola Oil, Potassium Citrate, Calcium Phosphate Tribasic, Sodium Citrate, Magnesium
Chloride, Magnesium Phosphate Dibasic, Artificial Flavor, Sodium Chloride, Soy Lecithin, Choline Chloride, Ascorbic Acid, Carrageenan, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Gellan Gum, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Folic Acid,
Sodium Molybdate, Chromium Chloride, Biotin, Potassium Iodide, Sodium Selenate.
B. ENSURE® BARS Usage: ENSURE BARS are complete, balanced nutrition for supplemental use between or with meals. They provide a delicious, nutrient-rich alternative to other snacks. ENSURE BARS contain <1 g lactose/bar, and Chocolate Fudge Brownie flavor is gluten-free. (Honey Graham Crunch flavor contains gluten.)
Patient Conditions: • For patients who need extra calories, protein, vitamins and minerals
• Especially useful for people who do not take in enough calories and nutrients
• For people who have the ability to chew and swallow
• Not to be used by anyone with a peanut allergy or any type of allergy to nuts. Ingredients: Honey Graham Crunch - High-Fructose Corn Syrup, Soy Protein Isolate,
Brown Sugar, Honey, Maltodextrin (Corn), Crisp Rice (Milled Rice, Sugar [Sucrose], Salt [Sodium Chloride] and Malt), Oat Bran, Partially Hydrogenated Cottonseed and Soy Oils, Soy Polysaccharide, Glycerine, Whey Protein Concentrate, Polydextrose, Fructose, Calcium Caseinate, Cocoa Powder, Artificial Flafors, Canola Oil, High-Oleic Safflower Oil, Nonfat Dry Milk, Whey Powder, Soy Lecithin and Corn Oil. Manufactured in a facility that processes nuts.
Vitamins and Minerals:
Calcium Phosphate Tribasic, Potassium Phosphate Dibasic, Magnesium Oxide, Salt (Sodium Chloride), Potassium Chloride, Ascorbic Acid, Ferric
Orthophosphate, Alpha-Tocopheryl Acetate, Niacinamide, Zinc Oxide, Calcium Pantothenate, Copper Gluconate, Manganese Sulfate, Riboflavin, Beta-Carotene, Pyridoxine Hydrochloride, Thiamine Mononitrate, Folic Acid, Biotin, Chromium Chloride, Potassium Iodide, Sodium Selenate, Sodium Molybdate, Phylloquinone, Vitamin D3 and Cyanocobalamin.
Protein:
Honey Graham Crunch - The protein source is a blend of soy protein isolate and milk proteins.
Soy protein isolate 74% Milk proteins 26%
Fat:
Honey Graham Crunch - The fat source is a blend of partially hydrogenated cottonseed and soybean, canola, high oleic safflower, and corn oils, and soy lecithin. Partially hydrogenated cottonseed and soybean oil 76%
Canola oil 8%
High-oleic safflower oil 8%
Corn oil 4%
Soy lecithin 4% Carbohydrate:
Honey Graham Crunch - The carbohydrate source is a combination of high- fructose corn syrup, brown sugar, maltodextrin, honey, crisp rice, glycerine, soy polysaccharide, and oat bran. High-fructose corn syrup 24%
Brown sugar 21%
Maltodextrin 12%
Honey 11% Crisp rice 9%
Glycerine 9%
Soy polysaccharide 7%
Oat bran 7%
C. ENSURE® HIGH PROTEIN
Usage: ENSURE HIGH PROTEIN is a concentrated, high-protein liquid food designed for people who require additional calories, protein, vitamins, and minerals in their diets. It can be used as an oral nutritional supplement with or between meals or, in appropriate amounts, as a meal replacement. ENSURE HIGH PROTEIN is lactose- and gluten-free, and is suitable for use by people recovering from general surgery or hip fractures and by patients at risk for pressure ulcers.
Patient Conditions
• For patients who require additional calories, protein, vitamins, and minerals, such as patients recovering from general surgery or hip fractures, patients at risk for pressure ulcers, and patients on low-cholesterol diets
Features-
• Low in saturated fat
• Contains 6 g of total fat and < 5 mg of cholesterol per serving • Rich, creamy taste
• Excellent source of protein, calcium, and other essential vitamins and minerals
• For low-cholesterol diets
• Lactose-free, easily digested Ingredients:
Vanilla Supreme: Water, Sugar (Sucrose), Maltodextrin (Corn), Calcium and Sodium Caseinates, High-Oleic Safflower Oil, Soy Protein Isolate, Soy Oil, Canola Oil, Potassium Citrate, Calcium Phosphate Tribasic, Sodium Citrate, Magnesium Chloride, Magnesium Phosphate Dibasic, Artificial Flavor, Sodium Chloride, Soy
Lecithin, Choline Chloride, Ascorbic Acid, Carrageenan, Zinc Sulfate, Ferrous Suffate, Alpha-Tocopheryl Acetate, Gellan Gum, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Folio Acid, Sodium Motybdate, Chromium Chloride, Biotin, Potassium Iodide, Sodium
Selenate, Phylloquinone, Vitamin D.3 and Cyanocobalamin.
Protein:
The protein source is a blend of two high-biologic-value proteins: casein and soy.
Sodium and calcium caseinates 85% Soy protein isolate 15%
Fat:
The fat source is a blend of three oils: high-oleic safflower, canola, and soy.
High-oleic safflower oil 40%
Canola oil 30% Soy oil 30%
The level of fat in ENSURE HIGH PROTEIN meets American Heart Association (AHA) guidelines. The 6 grams of fat in ENSURE HIGH PROTEIN represent 24% of the total calories, with 2.6% of the fat being from saturated fatty acids and 7.9% from polyunsaturated fatty acids. These values are within the AHA guidelines of < 30% of total calories from fat, < 1 0% of the calories from saturated fatty acids, and < 1 0% of total calories from polyunsaturated fatty acids.
Carbohydrate:
ENSURE HIGH PROTEIN contains a combination of maltodextrin and sucrose. The mild sweetness and flavor variety (vanilla supreme, chocolate royal, wild berry, and banana), plus VARI-FLAVORSO® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, help to prevent flavor fatigue and aid in patient compliance.
Vanilla and other nonchocolate flavors Sucrose 60%
Maltodextrin 40% Chocolate
Sucrose 70%
Maltodextrin 30%
D. ENSURE ® LIGHT
Usage: ENSURE LIGHT is a low-fat liquid food designed for use as an oral nutritional supplement with or between meals. ENSURE LIGHT is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets.
Patient Conditions:
• For normal-weight or overweight patients who need extra nutrition in a supplement that contains 50% less fat and 20% fewer calories than ENSURE
• For healthy adults who don't eat right and need extra nutrition Features:
• Low in fat and saturated fat
• Contains 3 g of total fat per serving and < 5 mg cholesterol
• Rich, creamy taste
• Excellent source of calcium and other essential vitamins and minerals • For low-cholesterol diets
• Lactose-free, easily digested Ingredients:
French Vanilla: Water, Maltodextrin (Corn), Sugar (Sucrose), Calcium Caseinate, High-Oleic Safflower Oil, Canola Oil, Magnesium Chloride, Sodium Citrate, Potassium Citrate, Potassium Phosphate Dibasic, Magnesium Phosphate Dibasic, Natural and Artificial Flavor, Calcium Phosphate Tribasic, Cellulose Gel,
Choline Chloride, Soy Lecithin, Carrageenan, Salt (Sodium Chloride), Ascorbic Acid, Cellulose Gum, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Zinc Sulfate, Niacinamide, Manganese Sulfate, Calcium Pantothenate, Cupric Sulfate, Thiamine Chloride Hydrochloride, Vitamin A Palmitate, Pyridoxine Hydrochloride, Riboflavin, Chromium Chloride, Folic Acid, Sodium Molybdate, Biotin, Potassium
Iodide, Sodium Selenate, Phylloquinone, Vitamin D3 and Cyanocobalamin.
Protein:
The protein source is calcium caseinate.
Calcium caseinate 100% Fat
The fat source is a blend of two oils: high-oleic safflower and canola.
High-oleic safflower oil 70%
Canola oil 30%
The level of fat in ENSURE LIGHT meets American Heart Association (AHA) guidelines. The 3 grams of fat in ENSURE LIGHT represent 13.5% of the total calories, with 1.4% of the fat being from saturated fatty acids and 2.6% from polyunsaturated fatty acids. These values are within the AHA guidelines of < 30% of total calories from fat, < 1 0% of the calories from saturated fatty acids, and < 1 0% of total calories from polyunsaturated fatty acids. Carbohydrate
ENSURE LIGHT contains a combination of maltodextrin and sucrose. The chocolate flavor contains corn syrup as well. The mild sweetness and flavor variety (French vanilla, chocolate supreme, strawberry swirl), plus VARI- FLAVORS® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, help to prevent flavor fatigue and aid in patient compliance.
Vanilla and other nonchocolate flavors
Sucrose 51% Maltodextrin 49%
Chocolate
Sucrose 47.0%
Corn Syrup 26.5%
Maltodextrin 26.5% Vitamins and Minerals
An 8-fl-oz serving of ENSURE LIGHT provides at least 25% of the RDIs for 24 key vitamins and minerals.
Caffeine
Chocolate flavor contains 2.1 mg caffeine/8 fl oz.
E. ENSURE PLUS®
Usage: ENSURE PLUS is a high-calorie, low-residue liquid food for use when extra calories and nutrients, but a normal concentration of protein, are needed. It is designed primarily as an oral nutritional supplement to be used with or between meals or, in appropriate amounts, as a meal replacement. ENSURE
PLUS is lactose- and gluten-free. Although it is primarily an oral nutritional supplement, it can be fed by tube.
Patient Conditions:
• For patients who require extra calories and nutrients, but a normal concentration of protein, in a limited volume
• For patients who need to gain or maintain healthy weight Features
• Rich, creamy taste
• Good source of essential vitamins and minerals
Ingredients Vanilla: Water, Com Syrup, Maltodextrin (Com), Com Oil, Sodium and Calcium
Caseinates, Sugar (Sucrose), Soy Protein Isolate, Magnesium Chloride, Potassium Citrate, Calcium Phosphate Tribasic, Soy Lecithin, Natural and Artificial Flavor, Sodium Citrate, Potassium Chloride, Choline Chloride, Ascorbic Acid, Carrageenan, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Thiamine
Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Vitamin A Palmitate, Folic Acid, Biotin, Chromium Chloride, Sodium Molybdate, Potassium Iodide, Sodium Selenite, Phylloquinone, Cyanocobalamin and Vitamin D3.
Protein The protein source is a blend of two high-biologic-value proteins: casein and soy.
Sodium and calcium caseinates 84%
Soy protein isolate 16%
Fat The fat source is co oil.
Com oil 100%
Carbohydrate
ENSURE PLUS contains a combination of maltodextrin and sucrose. The mild sweetness and flavor variety (vanilla, chocolate, strawberry, coffee, buffer pecan, and eggnog), plus VARI-FLAVORS® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, help to prevent flavor fatigue and aid in patient compliance.
Vanilla, strawberry, butter pecan, and coffee flavors Com Syrup 39%
Maltodextrin 38%
Sucrose 23%
Chocolate and eggnog flavors Com Syrup 36%
Maltodextrin 34%
Sucrose 30%
Vitamins and Minerals
An 8-fl-oz serving of ENSURE PLUS provides at least 15% of the RDIs for 25 key Vitamins and minerals.
Caffeine
Chocolate flavor contains 3.1 mg Caffeine/8 fl oz. Coffee flavor contains a trace amount of caffeine.
F. ENSURE PLUS® HN
Usage: ENSURE PLUS HN is a nutritionally complete high-calorie, high- nitrogen liquid food designed for people with higher calorie and protein needs or limited volume tolerance. It may be used for oral supplementation or for total nutritional support by tube. ENSURE PLUS HN is lactose- and gluten-free. Patient Conditions:
• For patients with increased calorie and protein needs, such as following surgery or injury
• For patients with limited volume tolerance and early satiety Features • For supplemental or total nutrition
• For oral or tube feeding • 1.5 CaVmL
• High nitrogen
• Calorically dense
Ingredients Vanilla: Water, Maltodextrin (Com), Sodium and Calcium Caseinates, Com Oil,
Sugar (Sucrose), Soy Protein Isolate, Magnesium Chloride, Potassium Citrate, Calcium Phosphate Tribasic, Soy Lecithin, Natural and Artificial Flavor, Sodium Citrate, Choline Chloride, Ascorbic Acid, Taurine, L-Carnitine, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Niacinamide, Carrageenan, Calcium Pantothenate, Manganese Sulfate, Cupric Sulfate, Thiamine Chloride
Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Vitamin A Palmitate, Folic Acid, Biotin, Chromium Chloride, Sodium Molybdate, Potassium Iodide, Sodium Selenite, Phylloquinone, Cyanocobalamin and Vitamin D3.
G. ENSURE® POWDER
Usage: ENSURE POWDER (reconstituted with water) is a low-residue liquid food designed primarily as an oral nutritional supplement to be used with or between meals. ENSURE POWDER is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets. Patient Conditions:
• For patients on modified diets
• For elderly patients at nutrition risk
• For patients recovering from illness/surgery
• For patients who need a low-residue diet Features
• Convenient, easy to mix
• Low in saturated fat • Contains 9 g of total fat and < 5 mg of cholesterol per serving
• High in vitamins and minerals
• For low-cholesterol diets
• Lactose-free, easily digested Ingredients: Com Syrup, Maltodextrin (Com), Sugar (Sucrose), Com Oil,
Sodium and Calcium Caseinates, Soy Protein Isolate, Artificial Flavor, Potassium Citrate, Magnesium Chloride, Sodium Citrate, Calcium Phosphate Tribasic, Potassium Chloride, Soy Lecithin, Ascorbic Acid, Choline Chloride, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Niacinamide, Calcium Pantothenate, Manganese Sulfate, Thiamine Chloride Hydrochloride, Cupric Sulfate, Pyridoxine
Hydrochloride, Riboflavin, Vitamin A Palmitate, Folic Acid, Biotin, Sodium Molybdate, Chromium Chloride, Potassium Iodide, Sodium Selenate, Phylloquinone, Vitamin D3 and Cyanocobalamin.
Protein The protein source is a blend of two high-biologic-value proteins: casein and soy.
Sodium and calcium caseinates 84%
Soy protein isolate 16%
Fat The fat source is com oil.
Com oil 100%
Carbohydrate
ENSURE POWDER contains a combination of com syrup, maltodextrin, and sucrose. The mild sweetness of ENSURE POWDER, plus VARI- FLAVORS® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, helps to prevent flavor fatigue and aid in patient compliance.
Vanilla
Com Syrup 35% Maltodextrin 35% Sucrose 30%
H. ENSURE® PUDDING Usage: ENSURE PUDDING is a nutrient-dense supplement providing balanced nutrition in a nonliquid form to be used with or between meals. It is appropriate for consistency-modified diets (e.g., soft, pureed, or full liquid) or for people with swallowing impairments. ENSURE PUDDING is gluten-free.
Patient Conditions: • For patients on consistency-modified diets (e.g., soft, pureed, or full liquid)
• For patients with swallowing impairments
• Features
• Rich and creamy, good taste
• Good source of essential vitamins and minerals • Convenient-needs no refrigeration
• Gluten-free
Nutrient Profile per 5 oz: Calories 250, Protein 10.9%, Total Fat 34.9%, Carbohydrate 54.2%
Ingredients: Vanilla: Nonfat Milk, Water, Sugar (Sucrose), Partially Hydrogenated Soybean
Oil, Modified Food Starch, Magnesium Sulfate. Sodium Stearoyl Lactylate, Sodium Phosphate Dibasic, Artificial Flavor, Ascorbic Acid, Zinc Sulfate, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Choline Chloride, Niacinamide, Manganese Sulfate, Calcium Pantothenate, FD&C Yellow #5, Potassium Citrate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine
Hydrochloride, Riboflavin, FD&C Yellow #6, Folic Acid, Biotin, Phylloquinone, Vitamin D3 and Cyanocobalamin.
Protein The protein source is nonfat milk. Nonfat milk 100%
Fat
The fat source is hydrogenated soybean oil.
Hydrogenated soybean oil 100%
Carbohydrate
ENSURE PUDDING contains a combination of sucrose and modified food starch. The mild sweetness and flavor variety (vanilla, chocolate, butterscotch, and tapioca) help prevent flavor fatigue. The product contains 9.2 grams of lactose per serving.
Vanilla and other nonchocolate flavors
Sucrose 56% Lactose 27%
Modified food starch 17% Chocolate
Sucrose 58% Lactose 26% Modified food starch 16%
I. ENSURE® WITH FIBER
Usage: ENSURE WITH FIBER is a fiber-containing, nutritionally complete liquid food designed for people who can benefit from increased dietary fiber and nutrients. ENSURE WITH FIBER is suitable for people who do not require a low-residue diet. It can be fed orally or by tube, and can be used as a nutritional supplement to a regular diet or, in appropriate amounts, as a meal replacement. ENSURE WITH FIBER is lactose- and gluten-free, and is suitable for use in modified diets, including low-cholesterol diets. Patient Conditions
• For patients who can benefit from increased dietary fiber and nutrients Features
• New advanced formula-low in saturated fat, higher in vitamins and minerals • Contains 6 g of total fat and < 5 mg of cholesterol per serving
• Rich, creamy taste
• Good source of fiber
• Excellent source of essential vitamins and minerals
• For low-cholesterol diets • Lactose- and gluten-free
Ingredients
Vanilla: Water, Maltodextrin (Corn), Sugar (Sucrose), Sodium and Calcium Caseinates, Oat Fiber, High-Oleic Safflower Oil, Canola Oil, Soy Protein Isolate, Com Oil, Soy Fiber, Calcium Phosphate Tribasic, Magnesium Chloride, Potassium Citrate, Cellulose Gel, Soy Lecithin, Potassium Phosphate Dibasic, Sodium
Citrate, Natural and Artificial Flavors, Choline Chloride, Magnesium Phosphate, Ascorbic Acid, Cellulose Gum, Potassium Chloride, Carrageenan, Ferrous Sulfate, Alpha-Tocopheryl Acetate, Zinc Sulfate, Niacinamide, Manganese Sulfate, Calcium Pantothenate, Cupric Sulfate, Vitamin A Palmitate, Thiamine Chloride Hydrochloride, Pyridoxine Hydrochloride, Riboflavin, Folic Acid, Chromium
Chloride, Biotin, Sodium Molybdate, Potassium Iodide, Sodium Selenate, Phylloquinone, Vitamin D3 and Cyanocobalamin.
Protein
The protein source is a blend of two high-biologic-value proteins- casein and soy.
Sodium and calcium caseinates 80%
Soy protein isolate 20% Fat
The fat source is a blend of three oils: high-oleic safflower, canola, and com.
High-oleic safflower oil 40% Canola oil 40%
Com oil 20%
The level of fat in ENSURE WITH FIBER meets American Heart Association (AHA) guidelines. The 6 grams of fat in ENSURE WITH FIBER represent 22% of the total calories, with 2.01 % of the fat being from saturated fatty acids and 6.7% from polyunsaturated fatty acids. These values are within the
AHA guidelines of < 30% of total calories from fat, < 1 0% of the calories from saturated fatty acids, and < 1 0% of total calories from polyunsaturated fatty acids.
Carbohydrate
ENSURE WITH FIBER contains a combination of maltodextrin and sucrose. The mild sweetness and flavor variety (vanilla, chocolate, and butter pecan), plus VARI-FLAVORS® Flavor Pacs in pecan, cherry, strawberry, lemon, and orange, help to prevent flavor fatigue and aid in patient compliance.
Vanilla and other nonchocolate flavors
Maltodextrin 66% Sucrose 25%
Oat Fiber 7%
Soy Fiber 2% Chocolate
Maltodextrin 55% Sucrose 36%
Oat Fiber 7%
Soy Fiber 2% Fiber
The fiber blend used in ENSURE WITH FIBER consists of oat fiber and soy polysaccharide. This blend results in approximately 4 grams of total dietary fiber per 8-fl-oz can. The ratio of insoluble to soluble fiber is 95:5. The various nutritional supplements described above and known to others of skill in the art can be substituted and/or supplemented with the PUFAs of this invention.
J. Oxepa™ Nutritional Product
Oxepa is low-carbohydrate, calorically dense enteral nutritional product designed for the dietary management of patients with or at risk for ARDS. It has a unique combination of ingredients, including a patented oil blend containing eicosapentaenoic acid (EPA from fish oil), γ-linolenic acid (GLA from borage oil), and elevated antioxidant levels.
Caloric Distribution: • Caloric density is high at 1.5 Cal/mL (355 Cal/8 fl oz), to minimize the volume required to meet energy needs.
• The distribution of Calories in Oxepa is shown in Table 7.
Figure imgf000100_0001
Fat: • Oxepa contains 22.2 g of fat per 8-fl oz serving (93.7 g/L).
• The fat source is a oil blend of 31.8% canola oil, 25% medium-chain triglycerides (MCTs), 20% borage oil, 20% fish oil, and 3.2 % soy lecithin. The typical fatty acid profile of Oxepa is shown in Table 8.
• Oxepa provides a balanced amount of polyunsaturated, monounsaturated, and saturated fatty acids, as shown in Table 10. • Medium-chain trigylcerides (MCTs) — 25% of the fat blend — aid gastric emptying because they are absorbed by the intestinal tract without emulsification by bile acids.
The various fatty acid components of Oxepa™ nutritional product can be substituted and/or supplemented with the PUFAs of this invention.
Figure imgf000101_0001
Carbohydrate:
• The carbohydrate content is 25.0 g per 8-fl-oz serving (105.5 g/L). • The carbohydrate sources are 45% maltodextrin (a complex carbohydrate) and 55% sucrose (a simple sugar), both of which are readily digested and absorbed.
• The high-fat and low-carbohydrate content of Oxepa is designed to minimize carbon dioxide (CO ) production. High CO2 levels can complicate weaning in ventilator-dependent patients. The low level of carbohydrate also may be useful for those patients who have developed stress-induced hyperglycemia.
• Oxepa is lactose-free.
Dietary carbohydrate, the amino acids from protein, and the glycerol moiety of fats can be converted to glucose within the body. Throughout this process, the carbohydrate requirements of glucose-dependent tissues (such as the central nervous system and red blood cells) are met. However, a diet free of carbohydrates can lead to ketosis, excessive catabolism of tissue protein, and loss of fluid and electrolytes. These effects can be prevented by daily ingestion of 50 to 100 g of digestible carbohydrate, if caloric intake is adequate. The carbohydrate level in Oxepa is also sufficient to minimize gluconeogenesis, if energy needs are being met.
Protein:
• Oxepa contains 14.8 g of protein per 8-fl-oz serving (62.5 g/L).
• The total calorie/nitrogen ratio (150: 1) meets the need of stressed patients. • Oxepa provides enough protein to promote anabolism and the maintenance of lean body mass without precipitating respiratory problems. High protein intakes are a concern in patients with respiratory insufficiency. Although protein has little effect on CO production, a high protein diet will increase ventilatory drive.
• The protein sources of Oxepa are 86.8% sodium caseinate and 13.2% calcium caseinate.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incoφorated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated as incoφorated by reference.
The invention now being fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

Claims

1. A transgenic insect cell comprising a nucleotide sequence which encodes a polypeptide wherein the sequence of the polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171-175, 203-212 and 387-394 of SEQ LD NO:2.
2. An oil or fraction thereof isolated from the insect cell of claim 1.
3. A method of treating or preventing malnutrition comprising administering said oil of claim 2 to a patient in need of said treatment or prevention in an amount sufficient to effect said treatment or prevention.
4. A pharmaceutical composition comprising said oil or fraction of claim 2 and a pharmaceutically acceptable carrier.
5. The pharmaceutical composition of claim 4, wherein said pharmaceutical composition is in the form of a solid or a liquid.
6. The pharmaceutical composition of claim 4, wherein said pharmaceutical composition is in a capsule or tablet form.
7. The pharmaceutical composition of claim 4 further comprising at least one nutrient selected from the group consisting of a vitamin, a mineral, a carbohydrate, a sugar, an amino acid, a free fatty acid, a phospholipid, an antioxidant, and a phenolic compound.
8. A nutritional formula comprising said oil or fraction thereof of claim 2.
9. The nutritional formula of claim 8, wherein said nutritional formula is selected from the group consisting of an infant formula, a dietary supplement, and a dietary substitute.
10. The nutritional formula of claim 9, wherein said infant formula, dietary supplement or dietary supplement is in the form of a liquid or a solid.
11. An infant formula comprising said oil or fraction thereof of claim 2.
12. The infant formula of claim 11 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
13. The infant formula of claim 12 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
14. A dietary supplement comprising said oil or fraction thereof of claim 2.
15. The dietary supplement of claim 14 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
16. The dietary supplement of claim 15 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
17. The dietary supplement of claim 16, wherein said dietary supplement is administered to a human or an animal.
18. A dietary substitute comprising said oil or fraction thereof of claim 2.
19. The dietary substitute of claim 18 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
20. The dietary substitute of claim 19 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
21. The dietary substitute of claim 20, wherein said dietary substitute is administered to a human or animal.
22. A method of treating a patient having a condition caused by insufficient intake or production of polyunsaturated fatty acids comprising administering to said patient said dietary substitute of claim 21 in an amount sufficient to effect said treatment.
23. The method of claim 22, wherein said dietary substitute is administered enterally or parenterally.
24. A cosmetic comprising said oil or fraction thereof of claim 2.
25. The cosmetic of claim 24, wherein said cosmetic is applied topically.
26. The pharmaceutical composition of claim 4, wherein said pharmaceutical composition is administered to a human or an animal.
27. An animal feed comprising said oil or fraction thereof of claim 2.
28. A method for producing an oil or fraction thereof comprising growing one or more transgenic insect cells under suitable conditions whereby said cells express a transgenic polypeptide wherein the sequence of said polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171-175, 203-212 and 387-394 of SEQ ID NO:2.
29. An oil or fraction thereof produced from the method of claim 28.
30. A method of treating or preventing malnutrition comprising administering said oil of claim 29 to a patient in need of said treatment or prevention in an amount sufficient to effect said treatment or prevention.
31. A pharmaceutical composition comprising said oil or fraction of claim 29 and a pharmaceutically acceptable carrier.
32. The pharmaceutical composition of claim 31, wherein said pharmaceutical composition is in the form of a solid or a liquid.
33. The pharmaceutical composition of claim 31 , wherein said pharmaceutical composition is in a capsule or tablet form.
34. The pharmaceutical composition of claim 31 further comprising at least one nutrient selected from the group consisting of a vitamin, a mineral, a carbohydrate, a sugar, an amino acid, a free fatty acid, a phospholipid, an antioxidant, and a phenolic compound.
35. A nutritional formula comprising said oil or fraction thereof of claim 29.
36. The nutritional formula of claim 35, wherein said nutritional formula is selected from the group consisting of an infant formula, a dietary supplement, and a dietary substitute.
37. The nutritional formula of claim 36, wherein said infant formula, dietary supplement or dietary supplement is in the form of a liquid or a solid.
38. An infant formula comprising said oil or fraction thereof of claim 29.
39. The infant formula of claim 38 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
40. The infant formula of claim 39 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
41. A dietary supplement comprising said oil or fraction thereof of claim 29.
42. The dietary supplement of claim 41 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
43. The dietary supplement of claim 42 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
44. The dietary supplement of claim 43, wherein said dietary supplement is administered to a human or an animal.
45. A dietary substitute comprising said oil or fraction thereof of claim 29.
46. The dietary substitute of claim 45 further comprising at least one macronutrient selected from the group consisting of coconut oil, soy oil, canola oil, mono- and diglycerides, glucose, edible lactose, electrodialysed whey, electrodialysed skim milk, milk whey, soy protein, and other protein hydrolysates.
47. The dietary substitute of claim 46 further comprising at least one vitamin selected from the group consisting of Vitamins A, C, D, E, and B complex; and at least one mineral selected from the group consisting of calcium, magnesium, zinc, manganese, sodium, potassium, phosphoms, copper, chloride, iodine, selenium, and iron.
48. The dietary substitute of claim 47, wherein said dietary substitute is administered to a human or animal.
49. A method of treating a patient having a condition caused by insufficient intake or production of polyunsaturated fatty acids comprising administering to said patient said dietary substitute of claim 52 in an amount sufficient to effect said treatment.
50. The method of claim 49, wherein said dietary substitute or said dietary supplement is administered enterally or parenterally.
51. A cosmetic comprising said oil or fraction thereof of claim 29.
52. The cosmetic of claim 51 , wherein said cosmetic is applied topically.
53. The pharmaceutical composition of claim 31 , wherein said pharmaceutical composition is administered to a human or an animal.
54. An animal feed comprising said oil or fraction thereof of claim 19.
55. A baculovirus vector comprising a nucleotide sequence which encodes a polypeptide wherein the sequence of the polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171-175, 203-212 and 387-394 of SEQ ID NO:2.
56. An insect cell comprising the vector of claim 55.
57. The cell of claim 56 wherein said insect is of the genus Spodptera.
58. The cell of the claim 57 wherein said insect is of the species Frugiperda.
59. The cell of claim 57 wherein said insect is of the genus Trichoplusia.
60. The cell of claim 59 wherein said insect is of the species ni.
61. A method for producing an oil or fraction thereof comprising growing one or more transgenic insect cells under suitable conditions where said cells express a transgenic polypeptide wherein the sequence of said polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171- 175, 203-212 and 387-394 of SEQ ID NO:2.
62. The method according to claim 52 including the step of extracting said insect cells with an organic solvent.
63. The method according to claim 51 wherein said oil includes phosphatides and said phosphatides are removed by precipitation with water and with mild acid.
64. The method according to claim 53 wherein said oil is treated with phosphosphoric acid to precipitate said phosphatides.
65. The method of claim 54 wherein said phosphoric acid is neutralized with sodium hydroxide.
66. The method of claim 54 wherein said oil is treated with acid catalyzed clay or activated carbon.
67. The method of claim 54 including the further step of deodorizing said oil by subjecting said oil to steam distillation.
68. A method for producing a Δ5 desaturase polypeptide comprising growing one or more transgenic insect cells under suitable conditions where said cells express a transgenic polypeptide wherein the sequence of said polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171- 175, 203-212 and 387-394 or SEQ ID NO:2.
69. Isolated and purified Δ5 desaturase protein purified by the method of claim 68.
70. Antibodies directed to the protein of claim 69.
71. The antibodies of claim 70 wherein said antibodies are polyclonal antibodies.
72. The antibodies of claim 70 wherein said antibodies are polyclonal antibodies.
73. A method for production of arachidonic acid comprising growing one or more transgenic insect cells under suitable conditions where said cells express a transgenic polypeptide wherein the sequence of said polypeptide comprises a sequence selected from the group consisting of residues 30-38, 41-44, 171-175, 203-212 and 387-394 of SEQ ID No:2.
74. Isolated and purified arachidonic acid purified by the method of claim 73.
75. A nutritional supplement comprising the arachidonic acid of claim 74.
PCT/US1999/022692 1998-10-05 1999-09-29 Altered fatty acid biosynthesis in insect cells using delta five desaturase WO2000020603A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU65036/99A AU6503699A (en) 1998-10-05 1999-09-29 Altered fatty acid biosynthesis in insect cells using delta five desaturase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10310998P 1998-10-05 1998-10-05
US60/103,109 1998-10-05

Publications (1)

Publication Number Publication Date
WO2000020603A1 true WO2000020603A1 (en) 2000-04-13

Family

ID=22293456

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/022692 WO2000020603A1 (en) 1998-10-05 1999-09-29 Altered fatty acid biosynthesis in insect cells using delta five desaturase

Country Status (2)

Country Link
AU (1) AU6503699A (en)
WO (1) WO2000020603A1 (en)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000040705A2 (en) * 1999-01-08 2000-07-13 Abbott Laboratories Human desaturase gene and uses thereof
WO2002026946A2 (en) * 2000-09-28 2002-04-04 Bioriginal Food & Science Corporation Fad4, fad5, fad5-2, and fad6, fatty acid desaturase family members and uses thereof
WO2002034940A2 (en) * 2000-10-26 2002-05-02 Xenon Genetics Inc. Methods for screening compounds that modulate lipid metabolism
US6428990B1 (en) 1997-04-11 2002-08-06 Abbott Laboratories Human desaturase gene and uses thereof
US6635451B2 (en) 2001-01-25 2003-10-21 Abbott Laboratories Desaturase genes and uses thereof
EP1366676A1 (en) * 2002-05-28 2003-12-03 Gabriele Danners Dietary foodstuff
WO2002081668A3 (en) * 2001-01-25 2003-12-18 Abbott Lab Desaturase genes and uses thereof
EP1656839A1 (en) * 2004-11-11 2006-05-17 N.V. Nutricia Nutrition containing lipid blend
EP1780275A1 (en) * 2004-07-12 2007-05-02 Suntory Limited Polypeptide having a delta 5 fatty acid unsaturating activity, polynucleotide coding for the polypeptide and use thereof
US7807849B2 (en) 2004-04-22 2010-10-05 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
WO2010126653A1 (en) * 2009-04-27 2010-11-04 Abbott Laboratories Antibodies against delta-5 desaturase and uses thereof
US7834250B2 (en) 2004-04-22 2010-11-16 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US8168611B1 (en) 2011-09-29 2012-05-01 Chemo S.A. France Compositions, kits and methods for nutrition supplementation
US8183227B1 (en) 2011-07-07 2012-05-22 Chemo S. A. France Compositions, kits and methods for nutrition supplementation
US8816111B2 (en) 2012-06-15 2014-08-26 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US8952217B2 (en) 2005-10-14 2015-02-10 Metanomics Gmbh Process for decreasing verbascose in a plant by expression of a chloroplast-targeted fimD protein
US9056086B2 (en) 2011-10-19 2015-06-16 Dignity Sciences Limited Pharmaceutical compositions comprising DGLA, 15-HEPE, and/or 15-HETrE and methods of use thereof
US9718759B2 (en) 2013-12-18 2017-08-01 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US9938486B2 (en) 2008-11-18 2018-04-10 Commonwealth Scientific And Industrial Research Organisation Enzymes and methods for producing omega-3 fatty acids
US10005713B2 (en) 2014-06-27 2018-06-26 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position
US10513717B2 (en) 2006-08-29 2019-12-24 Commonwealth Scientific And Industrial Research Organisation Synthesis of fatty acids

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996021037A1 (en) * 1995-01-03 1996-07-11 Martek Biosciences Corporation Arachidonic acid and methods for the production and use thereof
WO1998046765A1 (en) * 1997-04-11 1998-10-22 Calgene Llc Methods and compositions for synthesis of long chain polyunsaturated fatty acids

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996021037A1 (en) * 1995-01-03 1996-07-11 Martek Biosciences Corporation Arachidonic acid and methods for the production and use thereof
WO1998046765A1 (en) * 1997-04-11 1998-10-22 Calgene Llc Methods and compositions for synthesis of long chain polyunsaturated fatty acids

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KNUTZON D S ET AL: "Identification of Delta5 - desaturase from Mortierella alpina by heterologous expression in Bakers yeast and canola", JOURNAL OF BIOLOGICAL CHEMISTRY,US,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, vol. 273, no. 45, 6 November 1998 (1998-11-06), pages 29360 - 29366, XP002106760, ISSN: 0021-9258 *
MICHAELSON L ET AL: "Isolation of a delta5-fatty acid desaturase gene from Mortierella alpina", JOURNAL OF BIOLOGICAL CHEMISTRY,US,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, vol. 273, no. 30, 24 July 1998 (1998-07-24), pages 19055 - 19059, XP002076636, ISSN: 0021-9258 *

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6432684B1 (en) 1997-04-11 2002-08-13 Abbott Laboratories Human desaturase gene and uses thereof
US6858416B2 (en) 1997-04-11 2005-02-22 Abbott Laboratories Human desaturase gene and uses thereof
US6428990B1 (en) 1997-04-11 2002-08-06 Abbott Laboratories Human desaturase gene and uses thereof
WO2000040705A3 (en) * 1999-01-08 2000-11-09 Abbott Lab Human desaturase gene and uses thereof
WO2000040705A2 (en) * 1999-01-08 2000-07-13 Abbott Laboratories Human desaturase gene and uses thereof
US9359597B2 (en) 2000-09-28 2016-06-07 Bioriginal Food & Science Corp. Fad4, Fad5, Fad5-2, and Fad6, novel fatty acid desaturase family members and uses thereof
US8088906B2 (en) 2000-09-28 2012-01-03 Bioriginal Food & Science Corp. FAD4, FAD5, FAD5-2, and FAD6, novel fatty acid desaturase family members and uses thereof
AU2002218447C9 (en) * 2000-09-28 2008-04-17 Bioriginal Food & Science Corporation Fad4, Fad5, Fad5-2, and Fad6, fatty acid desaturase family members and uses thereof
EP1911837A3 (en) * 2000-09-28 2008-04-30 Bioriginal Food &amp; Science Corp. FAD4, FAD5, FAD5-2, and FAD6, fatty acid desaturase family members and uses thereof
CN105483142A (en) * 2000-09-28 2016-04-13 生物源食物及科学公司 FAD4, FAD5, FAD5-2, and FAD6, novel fatty acid desaturase family members and uses thereof
AU2002218447B2 (en) * 2000-09-28 2007-03-29 Bioriginal Food & Science Corporation Fad4, Fad5, Fad5-2, and Fad6, fatty acid desaturase family members and uses thereof
WO2002026946A2 (en) * 2000-09-28 2002-04-04 Bioriginal Food & Science Corporation Fad4, fad5, fad5-2, and fad6, fatty acid desaturase family members and uses thereof
WO2002026946A3 (en) * 2000-09-28 2003-05-08 Bioriginal Food & Science Corp Fad4, fad5, fad5-2, and fad6, fatty acid desaturase family members and uses thereof
US7977469B2 (en) 2000-09-28 2011-07-12 Bioriginal Food & Science Corp. Fad4, fad5, fad5-2, and fad6, novel fatty acid desaturase family members and uses thereof
US7671252B2 (en) 2000-09-28 2010-03-02 Bioriginal Food & Science Corp. Fad4, Fad5, Fad5-2, and Fad6, novel fatty acid desaturase family members and uses thereof
US7087432B2 (en) 2000-09-28 2006-08-08 Bioriginal Food & Science Corp. Fad4, Fad5, Fad5-2 and Fad6, novel fatty acid desaturase family members and uses thereof
WO2002034940A2 (en) * 2000-10-26 2002-05-02 Xenon Genetics Inc. Methods for screening compounds that modulate lipid metabolism
US7256028B2 (en) 2000-10-26 2007-08-14 Xenon Genetics Inc. Methods for screening compounds that modulate lipid metabolism
WO2002034940A3 (en) * 2000-10-26 2003-08-28 Xenon Genetics Inc Methods for screening compounds that modulate lipid metabolism
US8143486B2 (en) 2001-01-25 2012-03-27 Abbott Laboratories Delta-5 desaturase and uses thereof
EP2325300A1 (en) * 2001-01-25 2011-05-25 Abbott Laboratories Desaturase genes and uses thereof
US6635451B2 (en) 2001-01-25 2003-10-21 Abbott Laboratories Desaturase genes and uses thereof
WO2002081668A3 (en) * 2001-01-25 2003-12-18 Abbott Lab Desaturase genes and uses thereof
US7067285B2 (en) 2001-01-25 2006-06-27 Abbott Laboratories Desaturase genes and uses thereof
US8143383B2 (en) 2001-01-25 2012-03-27 Abbott Laboratories Δ-6 desaturase and uses thereof
US7241619B2 (en) 2001-01-25 2007-07-10 Abbott Laboratories Desaturase genes and uses thereof
EP2333052A1 (en) * 2001-01-25 2011-06-15 Abbott Laboratories Desaturase genes and uses thereof
EP1366676A1 (en) * 2002-05-28 2003-12-03 Gabriele Danners Dietary foodstuff
US8071341B2 (en) 2004-04-22 2011-12-06 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US8158392B1 (en) 2004-04-22 2012-04-17 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9453183B2 (en) 2004-04-22 2016-09-27 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US7834250B2 (en) 2004-04-22 2010-11-16 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US10781463B2 (en) 2004-04-22 2020-09-22 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US11220698B2 (en) 2004-04-22 2022-01-11 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US7807849B2 (en) 2004-04-22 2010-10-05 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US10443079B2 (en) 2004-04-22 2019-10-15 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US8106226B2 (en) 2004-04-22 2012-01-31 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US11597953B2 (en) 2004-04-22 2023-03-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9458410B2 (en) 2004-04-22 2016-10-04 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US7932438B2 (en) 2004-04-22 2011-04-26 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9994880B2 (en) 2004-04-22 2018-06-12 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9970033B2 (en) 2004-04-22 2018-05-15 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9963723B2 (en) 2004-04-22 2018-05-08 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9951357B2 (en) 2004-04-22 2018-04-24 Commonweatlh Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9926579B2 (en) 2004-04-22 2018-03-27 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US8853432B2 (en) 2004-04-22 2014-10-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
EP1780275A4 (en) * 2004-07-12 2008-05-28 Suntory Ltd Polypeptide having a delta 5 fatty acid unsaturating activity, polynucleotide coding for the polypeptide and use thereof
US7928294B2 (en) 2004-07-12 2011-04-19 Suntory Holdings Limited Polypeptide having Δ5 desaturating activity, polynucleotide coding for the polypeptide, and use thereof
EP1780275A1 (en) * 2004-07-12 2007-05-02 Suntory Limited Polypeptide having a delta 5 fatty acid unsaturating activity, polynucleotide coding for the polypeptide and use thereof
US8053471B2 (en) 2004-11-11 2011-11-08 N.V. Nutricia Nutrition containing fat blend
EP1656839A1 (en) * 2004-11-11 2006-05-17 N.V. Nutricia Nutrition containing lipid blend
EP2191733A1 (en) * 2004-11-11 2010-06-02 N.V. Nutricia Nutrition containing fat blend
US8729123B2 (en) 2004-11-11 2014-05-20 N.V. Nutricia Nutrition containing fat blend
WO2006050975A1 (en) * 2004-11-11 2006-05-18 N.V. Nutricia Nutrition containing fat blend
US8952217B2 (en) 2005-10-14 2015-02-10 Metanomics Gmbh Process for decreasing verbascose in a plant by expression of a chloroplast-targeted fimD protein
US10513717B2 (en) 2006-08-29 2019-12-24 Commonwealth Scientific And Industrial Research Organisation Synthesis of fatty acids
US9938486B2 (en) 2008-11-18 2018-04-10 Commonwealth Scientific And Industrial Research Organisation Enzymes and methods for producing omega-3 fatty acids
US8916154B2 (en) 2009-04-27 2014-12-23 Abbott Laboratories Antibodies against delta-5 desaturase and uses thereof
WO2010126653A1 (en) * 2009-04-27 2010-11-04 Abbott Laboratories Antibodies against delta-5 desaturase and uses thereof
US8183227B1 (en) 2011-07-07 2012-05-22 Chemo S. A. France Compositions, kits and methods for nutrition supplementation
US8168611B1 (en) 2011-09-29 2012-05-01 Chemo S.A. France Compositions, kits and methods for nutrition supplementation
US8545896B2 (en) 2011-09-29 2013-10-01 Chemo S. A. France Compositions, kits and methods for nutrition supplementation
US9056086B2 (en) 2011-10-19 2015-06-16 Dignity Sciences Limited Pharmaceutical compositions comprising DGLA, 15-HEPE, and/or 15-HETrE and methods of use thereof
US10335386B2 (en) 2012-06-15 2019-07-02 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9932289B2 (en) 2012-06-15 2018-04-03 Commonwealth Scientific And Industrial Research Ogranisation Process for producing ethyl esters of polyunsaturated fatty acids
US8946460B2 (en) 2012-06-15 2015-02-03 Commonwealth Scientific And Industrial Research Organisation Process for producing polyunsaturated fatty acids in an esterified form
US9550718B2 (en) 2012-06-15 2017-01-24 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9556102B2 (en) 2012-06-15 2017-01-31 Commonwealth Scientific And Industrial Research Organisation Process for producing ethyl esters of polyunsaturated fatty acids
US8816111B2 (en) 2012-06-15 2014-08-26 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9718759B2 (en) 2013-12-18 2017-08-01 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US9725399B2 (en) 2013-12-18 2017-08-08 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
US10190073B2 (en) 2013-12-18 2019-01-29 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
US10800729B2 (en) 2013-12-18 2020-10-13 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
US10125084B2 (en) 2013-12-18 2018-11-13 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US11623911B2 (en) 2013-12-18 2023-04-11 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US10793507B2 (en) 2014-06-27 2020-10-06 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the SN-2 position
US10005713B2 (en) 2014-06-27 2018-06-26 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position

Also Published As

Publication number Publication date
AU6503699A (en) 2000-04-26

Similar Documents

Publication Publication Date Title
EP1007691B1 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids
US8722384B2 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids
EP0996732B1 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids in plants
WO2000020603A1 (en) Altered fatty acid biosynthesis in insect cells using delta five desaturase
WO1998046765A9 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids
WO1998046764A9 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids in plants
WO1998046763A9 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids
MXPA99009329A (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids
EP1141252A2 (en) Human desaturase gene and uses thereof
WO2000020602A2 (en) Delta 6 and delta 12 desaturases and modified fatty acid biosynthesis and products produced therefrom
US7745694B1 (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids in plants
MXPA99009328A (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids in plants
MXPA99009327A (en) Methods and compositions for synthesis of long chain polyunsaturated fatty acids

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: AU

Ref document number: 1999 65036

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 09807048

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase