WO2005002324A2 - Method of producing double low restorer lines of brassica napus having a good agronomic value - Google Patents
Method of producing double low restorer lines of brassica napus having a good agronomic value Download PDFInfo
- Publication number
- WO2005002324A2 WO2005002324A2 PCT/IB2004/002491 IB2004002491W WO2005002324A2 WO 2005002324 A2 WO2005002324 A2 WO 2005002324A2 IB 2004002491 W IB2004002491 W IB 2004002491W WO 2005002324 A2 WO2005002324 A2 WO 2005002324A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pgiint
- pgiol
- boljon
- marker
- brassica
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
- A01H1/022—Genic fertility modification, e.g. apomixis
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/20—Brassicaceae, e.g. canola, broccoli or rucola
- A01H6/202—Brassica napus [canola]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Definitions
- the invention relates to a method of producing a double low restorer lines of Brassica napus for Ogura cytoplasmic male sterility (cms) presenting a radish introgression carrying the Rfo restorer genes deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterized by female fertility, a good transmission rate of Rfo and a high vegetative vigour.
- the invention relates also to a method of forming Brassica napus hybrid seed and progeny thereof and to the use of markers for selection.
- a first object of the present invention relates to a method of producing double low restorer lines of Brassica napus for Ogura cytoplasmic male sterility (cms) presenting radis introgression carrying the Rfo restorer gene deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour, said method including the step of: a) crossing double low cms lines of spring Brassica napus comprising a deleted radish insertion with the double low line of spring Drakkar for forming heterozygous restored plants of Brassica napus, b) irradiating before meiosis the heterozygous restored plants obtained in step a) with gamma
- lines(s) means a plant which is essentially homozygote and which is reproducible by auto-pollination.
- the double low cms line of spring Brassica napus of step a) is
- R211 is an INRA spring restorer line.
- Drakkar is a French spring registered variety.
- Wesroona is an Australian spring registered variety.
- the testing is performed with the combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon and CP418.
- Another object of the present invention relates to double low restorer lines of
- Brassica napus for Ogura cms presenting a Rfo insertion deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.
- the double low restorer lines present a unique combination of five markers selected from PGIol, PGIUNT,
- Another object of the present invention relates to a method of forming Brassica napus hybrid plants and progeny thereof obtained though the steps of: a) providing a restorer line produced according to claim 1 and bred to be homozygous, b) using said restorer line in a hybrid production field as the pollinator, c) using cms sterile plants in a hybrid production field as the hybrid seed producing plant, and d) harvesting the hybrid seed from the male sterile plant.
- Another object of the present invention relates to seeds of Brassica plant obtained from the methods according to the present invention.
- Still another object of the invention relates to seeds of Brassica napus deposited in
- Another object of the present invention relates to the use of at least four markers
- PGIol, PGIint, BolJon and CP418, or any portion of them comprising at least one polymorphic site, for characterising recombined restorer lines of Brassica napus for
- Ogura cms presenting a Rfo insertion deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.
- the combination is of five markers PGIol, PGIUNT,
- the expression "any portion of them comprising at least one polymorphic site” means any part of the sequence showing at least a difference between the B.oleracea type sequence and B.rapa type sequence.
- the present invention relates to:
- the marker PGIol which is amplified using the primers: PGIol U and PGIol L (PGIol U: 5TCATTTGATTGTTGCGCCTG3'; PGIol L: 5 GTACATCAGACCCGGTAGAAAA3')
- the marker PGIint which is amplified using the primers: PGIint U and PGIint L (PGIint U: 5'CAGCACTAATCTTGCGGTATG3 ' ; PGIint L: 5*CAATAACCCTAAAAGCACCTG3')
- PGIol U and PGIint L The marker PGIUNT which is amplified using the primers: PGIol U and PGIint L: (PGIol U: 5 CATTTGATTGTTGCGCCTG3'; PGIint L: 5'CAATAACCCTAAAAGCACCTG3')
- BolJon U and BolJon L The marker BolJon which is amplified using the primers: BolJon U and BolJon L: (BolJon U: 5'GATCCGATTCTTCTCCTGTTG3'; BolJon L: 5'GCCTACTCCTCAAATCACTCT3' )
- AATCTTGCGG TATGAATTTG TGATTAAATT TGTTTGTTTG TGACTCTTTC TTCATTGTTC 180 GTTTTCGTAC AATAAACCGA ATGTATAATC TTTTTACAAA CTGAATTTTC TACCGGGTCT 240
- CTTAGGCATA TTCTTTCTAT TTTATTTCCC TCTTAATGAT TTCTTCTTTT TTTTATTGCA 660
- AAAATGTCTT AGGCATATTC TTTCTATTTT ATTTCCCTCT TAATGATTTC TTCTTTTTTT 540
- TATTGCATTC CCGTTTTATT TTCAAAAGTT GTTACTGTCT CTAAATCAAG AAGAAACCTT 600 CTTAGTAGAT CCAGCTGATA TTCAGCCTTT TTTAAATTGG ACTGCAGGTT TTTAAAGGGG 660 AGCTTCAAGC ATTGATAAGC ATTTCCAGTC CACACCGTTT GAGAAGAATA TACCCGTGAG 720 TTGCATTAGT TGTGTGATTA TACAGTTTTC TTGTCTTTTT GCTATGTCCA ' TCAACACTAG 780 AGATTCGTGA AGTTATTAGT GTAGTCAACG CATAGGGAGA GGTGATT ' GGT GACTTTTGGA 840 CGATTTCAGG TGCTTTAGGG TTATTG ' 866
- Dra Drakkar Dra Drakkar
- FIG. 2 illustrates seed set on ,'R211 ' and 'R2000' .
- PGIol - primer PGIol U (named in SGAP: BnPGIch 1 U) - primer PGIol L (named in SGAP: Bn PGIch 1 L)
- PGIint - primer PGIint U - primer PGIint L (is out side the sequence).
- Figure 5 illustrates electrophoresis gel of PGI-2 gene (PGIol), PCR marker and SG34, a PCR marker close to Rfo.
- FIG. 6 illustrates Pgi-2 segment of DNA amplified by PCR with PGIol primers.
- FIG. 7 illustrates digestion of the PCR product PGIol by Msel .
- Sam and Darm has a 75bp band.
- Drak, R21 l.Dk and R2000 showed a 70pb one (Acrylamide 15%).
- FIG. 8 illustrates electrophoresis agarose gel of PGIUNT marker. In that figure:
- PGIUNT band (about 980bp) is present in B.oleracea, B.rapa cv Asko, maintainer and restored lines except in 'R211 '. There is no amplification in radish and Arabidopsis.
- FIG. 9 illustrates electrophoresis gel of PGIint PCR marker.
- PGIint of radish line 7 is of about 950bp. This band is the same as in the restored RRHl and Rl 13. It is not found in R211. It is not either in R2000. However the PGIint band is of a similar size of about 870bp in the various Brassica species, but sequences are different.
- FIG. 10 illustrates electrophoresis agarose gel of BolJon PCR marker.
- FIG. 11 illustrates electrophoresis agarose gel of CP418 marker.
- the CP418 band (of about 670bp) is specific to the B.oleracea genome. It is present in B.ol, B.napus (Samourai. Drakkar, Pactol and the herterozygous R2111*Dk). It is absent from the restored rapeseed (RRH, R113 and R211). It is present in the homozygous R2000.
- - Figure 12 illustrates summary markers table.
- FIG. 13 (13(a)J30 )) illustrates PGIol marker sequence alignment between Arabidopsis, Radish, B.rapa, B.oleracea and R2000.
- FIG. 14 (14(a). 14(b). 14(c). 14(d)) illustrates the PGlint-UNT marker sequence alignment between Arabidopsis, Radish, B.rapa, B.oleracea and R2000.
- - Figure 15 (15(a). 15(b). 15(c)) illustrates the CP418L marker sequence alignment between Arabidopsis, Radish, B.rapa, B.oleracea and R2000.
- FIG. 16 (16 et 16bis) illustrates Arabidopsis, Radish and B.rapa BolJon markers. There are aligned with DB sequences of Arabidopsis (AC007190end- ACOl lOOObeginning), the B.oleracea EMBH959102 end and EMBH448336 begining and representative consensus sequences of the SG129markers band 1 and 2 in B.napus (in Drakkar and Samourai respectively).
- the radish and B.rapa (GCPconsen RsRf BOJ and BR) sequences are still closely homologous to the B.napus one, from 858bp point to the 900bp and 981 points respectively.
- FIG. 18 illustrates the BolJon primers localisation on the mipsAtl62850 gene and overlapping area of AC007190 and AC011000 Arabidopsis th clones. Alignment with the Arabidopsis BolJon PCR product (740bp) is presented. It should be understood, however, that the examples are given solely by way of illustration of the object of the invention, of which they in no way constitute a limitation.
- Example I method of producing a double low restorer line of Brassica napus for Ogura cytoplasmic male sterility (cms) presenting a radish introgression, carrying the Rfo restorer gene deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.
- Materials and methods :
- Genotypes The 'R211 ' line with a deleted radish insertion was crossed to the spring low GLS rapeseed 'Drakkar' to produce a FI progeny ('R211*Dk').
- the spring low GLS cms line 'Wesroona' (australian origin) was used for following crosses.
- Gamma ray irradiation Whole flowering plants were treated with gamma rays from a Co60 source in a controlled area. Subletal dose fo 65 Gray was applied before meioses.
- Testcrosses and F2 production Irradiated plants were transferred in an insectproof greenhouse after removing flower buds larger than 2 mm. The irradiated FI progeny was used to handpoUinate the cms 'Wesroona' line. The restored derived FI' plants were allowed to produce F2 families harvested individually and precisely sown in a field assay along with non irradiated controls (Fig 1).
- Phenotypic selection Three visual criteria were scored (on a 1 to 5 scale) over 2 years in field assays, on 1200 F2 offsprings plus 44 controls (82 330 quoted plants): 1 -Vegetative vigour, 2- Normality of the ratio of fertile /sterile plants in the F2 segregation, and 3- Female fertility (pod development and seed set). Advanced selfed generations of the selected families were obtained either in field or greenhouse and produced homozygous lines (F4) for further analysis.
- the homozygous 'R211' shows linked negative traits such as low vigour and very poor seed set.
- these plant lack a rapeseed chromosomal segment.
- the fertile ratio in F2 progenies derived from this material is lower than expected (64% instead of 75%).
- Ionising irradiation is known to induce chromosomal rearrangements by double strand breaks followed by aberrant rejoining of the ends.Gamma-ray irradiation was used on a heterozygous FI derived from the 'R2H' line to induce chromosome breaks, just before meiosis, aiming at a recombination of the deleted radish introgression in the rapeseed genome.
- PGI isoenzyme analysis 'R2000' progeny expressed the rapeseed Pgi-2 allele from
- PGIUnt marker a combination of the PGI ol U and PGI int L primers. This marker had the specificity of the PGIol marker but amplifying a longer part as for PGIint one.
- the Pgi-2 gene is present in the R2000 homozygote, which is not the case for the parental homozygous R211.
- figure 5 PGIol and SG34 PCR markers: The homozygous 'R2000' family has recovered the PGIol band.
- the homozygous 'R2000' family has recovered the PGIol band of the Brassica oleracea type. It was distinct from the known restorer of the Samourai group. This amplified part of the Pgi-2 is very conserved and hardly any differences were shown among the various genotypes. A longer part of Pgi-2 gene was investigated. ⁇ .2 PGIUNT and PGIint markers
- PGIUNT marker A second reverse primer, PGIint L, was designed further down the Pgi-2 sequence, to amplify as well conserved and as variable regions of the gene. When used with the PGIol U primer, it amplifies a 980bp band only in Brassica genomes.
- PGIint marker amplified a segment of PGIUNT.
- the upper primer PGIint allows the amplification in all tested species, allowing a clear distinction between Arabidopsis, Radish and Brassica.
- B.rapa and B.oleracea were not distinguished by the band size on agarose gel, but by their PGIint sequence. All tested restored genotypes, but the 'R2i line, exhibited the European radish band and one Brassica band, homologous to the B.rapa one.
- the homozygous 'R2000' didn't show the radish PGIint band, as in the deleted 'R211 ' parental line, but showed one Brassica band, homologous to the B. oleracea one.
- Electrophoresis of PGIint marker is represented in figure 9. Sequence analysis:
- Example III selection of marker in a region close to Rfo
- FIG 16 (electrophoresis gel of BolJon PCR products): In Arabidopsis, a BolJon 815bp band was amplified, homologue to the overlapping segment of the contigs. In Brassiceae diploid species, BolJon marker showed distinct bands: one of 950bp in B.oleracea and one of 870bp in B.rapa. It showed that the two B.oleracea clones (EMBH53971 and EMBH448336) are in sequence continuity in Brassica genome as it is for the ortholog sequences in Arabidopsis. In B.napus, these two bands are co-amplified in the maintainer lines, Samourai or Drakkar.
- a new recombined low GLS restorer line has been selected with a good female fertility.
- the poor value of line 'R211 ' allowed selection in the field for a rare recombination event and characterisation the 'R2000' family.
- the homozygous 'R2000' presents a unique combination of the PGIol, PGIUNT,
- PGIinT marker showed that the homozygous restored rapeseed lines, RRHl and R113 presented the European radish band plus one Brassica band, homologous to
- PGIol marker and PGIUNT marker sequences in restored lines RRHl and R113 were homologous to the B.rapa cv Asko one.
- PGIUNT sequence is homologous to B.oleracea.
- the ortholog PGIUnt sequence in its B.rapa genome is not amplified with this marker in R211 and Drakkar genetic background.
- BolJon marker showed that the homozygous restored rapeseed lines, including 'R211' presented the European radish band plus only the B.rapa one. 'R2000' shows the two bands of 'R211 ' plus the recovered B.oleracea BolJon band.
- CP418 marker showed that 'R2000' recovered this conserved B.oleracea segment.
- Our hypothesis is that a recombination event took place in the pollen mother cell - which gave rise to 'R2000' plants.
- the deleted radish introgression was then integrated to the normal homologous chromosome segment, carrying the B.oleracea type Pgi-2 gene and BolJon target sequence, characterised by these markers, probably from the Drakkar '00' genome present in the irradiated heterozygous 'R211*DK'.
- the pattern observed for BolJon suggests that the recombination event resulted in a particular duplicated region, one from radish and one B.oleracea, in the 'R2000' family.
Abstract
Description
Claims
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP04744142A EP1641336A2 (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
US10/563,277 US7812217B2 (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of Brassica napus having a good agronomic value |
CN2004800190566A CN1816276B (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
CA2531051A CA2531051C (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
JP2006516608A JP2008504801A (en) | 2004-07-05 | 2004-07-05 | A method for producing a double low content recovery line of Brassica napus with high agricultural value |
AU2004253363A AU2004253363A1 (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of Brassica napus having a good agronomic value |
HK07101597.8A HK1094409A1 (en) | 2003-07-04 | 2007-02-09 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
US12/815,921 US8097776B2 (en) | 2003-07-04 | 2010-06-15 | Method of producing double low restorer lines of Brassica napus having a good agronomic value |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP03291677 | 2003-07-04 | ||
EP03291677.7 | 2003-07-04 | ||
EP03293057.0 | 2003-12-08 | ||
EP03293057A EP1493328A1 (en) | 2003-07-04 | 2003-12-08 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/563,277 A-371-Of-International US7812217B2 (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of Brassica napus having a good agronomic value |
US12/815,921 Continuation US8097776B2 (en) | 2003-07-04 | 2010-06-15 | Method of producing double low restorer lines of Brassica napus having a good agronomic value |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2005002324A2 true WO2005002324A2 (en) | 2005-01-13 |
WO2005002324A3 WO2005002324A3 (en) | 2005-02-17 |
Family
ID=33436133
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IB2004/002491 WO2005002324A2 (en) | 2003-07-04 | 2004-07-05 | Method of producing double low restorer lines of brassica napus having a good agronomic value |
Country Status (14)
Country | Link |
---|---|
US (2) | US7812217B2 (en) |
EP (4) | EP1493328A1 (en) |
CN (1) | CN1816276B (en) |
AU (2) | AU2004253363A1 (en) |
CA (1) | CA2531051C (en) |
CY (1) | CY1116159T1 (en) |
DK (2) | DK2298066T3 (en) |
ES (2) | ES2394990T3 (en) |
HK (1) | HK1094409A1 (en) |
PL (2) | PL2298066T3 (en) |
PT (2) | PT2179643E (en) |
RU (1) | RU2373698C2 (en) |
SI (2) | SI2298066T1 (en) |
WO (1) | WO2005002324A2 (en) |
Cited By (178)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2039772A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants introduction |
EP2039771A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
EP2039770A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
DE102007045922A1 (en) | 2007-09-26 | 2009-04-02 | Bayer Cropscience Ag | Drug combinations with insecticidal and acaricidal properties |
DE102007045953A1 (en) | 2007-09-26 | 2009-04-02 | Bayer Cropscience Ag | Active substance combination, useful for combating animal pest, treating seed, transgenic plant and seeds of transgenic plant, comprises a 5H-furan-2-one compound and other active agent comprising e.g. acrinathrin and alpha-cypermethrin |
DE102007045957A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. for combating animal pests e.g. insects and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. benzoyl urea, buprofezin and cyromazine |
DE102007045956A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Combination of active ingredients with insecticidal and acaricidal properties |
DE102007045919A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. to combat animal pest and to prepare insecticidal and acaricidal agent, comprises a substituted 5H-furan-2-one compound and a compound e.g. spirotetramat, spirodiclofen and spiromesifen |
DE102007045955A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. for combating animal pests and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. diazinon, isoxathion, carbofuran or aldicarb |
EP2072506A1 (en) | 2007-12-21 | 2009-06-24 | Bayer CropScience AG | Thiazolyloxyphenylamidine or thiadiazolyloxyphenylamidine und its use as fungicide |
EP2090168A1 (en) | 2008-02-12 | 2009-08-19 | Bayer CropScience AG | Method for improving plant growth |
DE102009001469A1 (en) | 2009-03-11 | 2009-09-24 | Bayer Cropscience Ag | Improving utilization of productive potential of transgenic plant by controlling e.g. animal pest, and/or by improving plant health, comprises treating the transgenic plant with active agent composition comprising prothioconazole |
DE102008041695A1 (en) | 2008-08-29 | 2010-03-04 | Bayer Cropscience Ag | Methods for improving plant growth |
EP2168434A1 (en) | 2008-08-02 | 2010-03-31 | Bayer CropScience AG | Use of azols to increase resistance of plants of parts of plants to abiotic stress |
EP2198709A1 (en) | 2008-12-19 | 2010-06-23 | Bayer CropScience AG | Method for treating resistant animal pests |
EP2201838A1 (en) | 2008-12-05 | 2010-06-30 | Bayer CropScience AG | Active ingredient-beneficial organism combinations with insecticide and acaricide properties |
EP2204094A1 (en) | 2008-12-29 | 2010-07-07 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants Introduction |
WO2010083955A2 (en) | 2009-01-23 | 2010-07-29 | Bayer Cropscience Aktiengesellschaft | Use of enaminocarboxylic compounds for fighting viruses transmitted by insects |
WO2010086311A1 (en) | 2009-01-28 | 2010-08-05 | Bayer Cropscience Ag | Fungicide n-cycloalkyl-n-bicyclicmethylene-carboxamide derivatives |
WO2010086095A1 (en) | 2009-01-29 | 2010-08-05 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants introduction |
EP2218717A1 (en) | 2009-02-17 | 2010-08-18 | Bayer CropScience AG | Fungicidal N-((HET)Arylethyl)thiocarboxamide derivatives |
WO2010094666A2 (en) | 2009-02-17 | 2010-08-26 | Bayer Cropscience Ag | Fungicidal n-(phenylcycloalkyl)carboxamide, n-(benzylcycloalkyl)carboxamide and thiocarboxamide derivatives |
WO2010094728A1 (en) | 2009-02-19 | 2010-08-26 | Bayer Cropscience Ag | Pesticide composition comprising a tetrazolyloxime derivative and a fungicide or an insecticide active substance |
DE102009001681A1 (en) | 2009-03-20 | 2010-09-23 | Bayer Cropscience Ag | Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi, microorganisms and/or improving plant health, comprises treating plant with a drug composition comprising iprovalicarb |
EP2232995A1 (en) | 2009-03-25 | 2010-09-29 | Bayer CropScience AG | Method for improved utilisation of the production potential of transgenic plants |
DE102009001730A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi and/or microorganisms and/or the plant health, comprises treating plant with a drug composition comprising spiroxamine |
DE102009001728A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising fluoxastrobin |
DE102009001732A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising trifloxystrobin |
EP2239331A1 (en) | 2009-04-07 | 2010-10-13 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
EP2251331A1 (en) | 2009-05-15 | 2010-11-17 | Bayer CropScience AG | Fungicide pyrazole carboxamides derivatives |
EP2255626A1 (en) | 2009-05-27 | 2010-12-01 | Bayer CropScience AG | Use of succinate dehydrogenase inhibitors to increase resistance of plants or parts of plants to abiotic stress |
WO2011006603A2 (en) | 2009-07-16 | 2011-01-20 | Bayer Cropscience Ag | Synergistic active substance combinations containing phenyl triazoles |
WO2011015524A2 (en) | 2009-08-03 | 2011-02-10 | Bayer Cropscience Ag | Fungicide heterocycles derivatives |
WO2011020698A1 (en) | 2009-08-03 | 2011-02-24 | Nickerson International Research | Brassica plant for restoring fertility in an ogura cytoplasmic male-sterility system, method for producing same, and use of said plant |
EP2292094A1 (en) | 2009-09-02 | 2011-03-09 | Bayer CropScience AG | Active compound combinations |
WO2011080255A2 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011080256A1 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011080254A2 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
EP2343280A1 (en) | 2009-12-10 | 2011-07-13 | Bayer CropScience AG | Fungicide quinoline derivatives |
WO2011089071A2 (en) | 2010-01-22 | 2011-07-28 | Bayer Cropscience Ag | Acaricide and/or insecticide active substance combinations |
EP2353387A1 (en) | 2010-02-05 | 2011-08-10 | Bayer CropScience AG | Use of succinate dehydrogenase (SDH) inhibitors in the treatment of plant types in the sweet grass family |
WO2011107504A1 (en) | 2010-03-04 | 2011-09-09 | Bayer Cropscience Ag | Fluoroalkyl-substituted 2-amidobenzimidazoles and the use thereof for boosting stress tolerance in plants |
WO2011113861A2 (en) | 2010-03-18 | 2011-09-22 | Bayer Cropscience Ag | Aryl and hetaryl sulfonamides as active agents against abiotic plant stress |
EP2374791A1 (en) | 2008-08-14 | 2011-10-12 | Bayer CropScience Aktiengesellschaft | Insecticidal 4-phenyl-1H pyrazoles |
WO2011124554A2 (en) | 2010-04-06 | 2011-10-13 | Bayer Cropscience Ag | Use of 4-phenylbutyric acid and/or the salts thereof for enhancing the stress tolerance of plants |
WO2011124553A2 (en) | 2010-04-09 | 2011-10-13 | Bayer Cropscience Ag | Use of derivatives of the (1-cyanocyclopropyl)phenylphosphinic acid, the esters thereof and/or the salts thereof for enhancing the tolerance of plants to abiotic stress |
EP2377397A1 (en) | 2010-04-14 | 2011-10-19 | Bayer CropScience AG | Use of fungicidal agents for controlling mycoses in palm trees |
WO2011134911A2 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011134913A1 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
WO2011134912A1 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
WO2011151370A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylalkyl)] pyrazole (thio)carboxamides and their heterosubstituted analogues |
WO2011151368A2 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2011151369A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues |
US8080688B2 (en) | 2007-03-12 | 2011-12-20 | Bayer Cropscience Ag | 3, 4-disubstituted phenoxyphenylamidines and use thereof as fungicides |
WO2012004221A2 (en) | 2010-07-07 | 2012-01-12 | Bayer Cropscience Ag | Anthranilamides in combination with fungicides |
WO2012010525A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Use of anthranilic acid amide derivatives for controlling insects and spider mites by watering, mixing with soil, drench treatment, droplet application, injection into the soil, stems or blossoms, in hydroponic systems, by treating the planting hole or immersion application, floating or seed box application or by the treatment of seeds, and for increasing the stress tolerance in plants to abiotic stress |
WO2012010579A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Benzocycloalkenes as antifungal agents |
WO2012028578A1 (en) | 2010-09-03 | 2012-03-08 | Bayer Cropscience Ag | Substituted fused pyrimidinones and dihydropyrimidinones |
WO2012038480A2 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of biological or chemical control agents for controlling insects and nematodes in resistant crops |
WO2012045798A1 (en) | 2010-10-07 | 2012-04-12 | Bayer Cropscience Ag | Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative |
WO2012052489A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | 1-(heterocyclic carbonyl) piperidines |
WO2012052490A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | N-benzyl heterocyclic carboxamides |
WO2012059497A1 (en) | 2010-11-02 | 2012-05-10 | Bayer Cropscience Ag | N-hetarylmethyl pyrazolylcarboxamides |
WO2012065947A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazolecarboxamides |
WO2012065944A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | N-aryl pyrazole(thio)carboxamides |
WO2012065945A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazole(thio)carboxamides |
EP2460406A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Use of fluopyram for controlling nematodes in nematode resistant crops |
EP2460407A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Agent combinations comprising pyridylethyl benzamides and other agents |
WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
WO2012089757A1 (en) | 2010-12-29 | 2012-07-05 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012089721A1 (en) | 2010-12-30 | 2012-07-05 | Bayer Cropscience Ag | Use of substituted spirocyclic sulfonamidocarboxylic acids, carboxylic esters thereof, carboxamides thereof and carbonitriles thereof or salts thereof for enhancement of stress tolerance in plants |
EP2474542A1 (en) | 2010-12-29 | 2012-07-11 | Bayer CropScience AG | Fungicide hydroximoyl-tetrazole derivatives |
EP2494867A1 (en) | 2011-03-01 | 2012-09-05 | Bayer CropScience AG | Halogen-substituted compounds in combination with fungicides |
WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
WO2012123434A1 (en) | 2011-03-14 | 2012-09-20 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012136581A1 (en) | 2011-04-08 | 2012-10-11 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
US8288426B2 (en) | 2006-12-22 | 2012-10-16 | Bayer Cropscience Ag | Pesticidal composition comprising fenamidone and an insecticide compound |
EP2511255A1 (en) | 2011-04-15 | 2012-10-17 | Bayer CropScience AG | Substituted prop-2-in-1-ol and prop-2-en-1-ol derivatives |
WO2012139892A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted 5-(bicyclo[4.1.0]hept-3-en-2-yl)-penta-2,4-dienes and 5-(bicyclo[4.1.0]hept-3-en-2-yl)-pent-2-ene-4-ines as active agents against abiotic stress in plants |
WO2012139890A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted 5-(cyclohex-2-en-1-yl)-penta-2,4-dienes and 5-(cyclohex-2-en-1-yl)-pent-2-en-4-ines as active agents against abiotic stress in plants |
WO2012139891A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted vinyl and alkinyl cyclohexenols as active agents against abiotic stress in plants |
US8334237B2 (en) | 2007-03-12 | 2012-12-18 | Bayer Cropscience Ag | Substituted phenylamidines and the use thereof as fungicides |
WO2013004652A1 (en) | 2011-07-04 | 2013-01-10 | Bayer Intellectual Property Gmbh | Use of substituted isoquinolinones, isoquinolindiones, isoquinolintriones and dihydroisoquinolinones or in each case salts thereof as active agents against abiotic stress in plants |
WO2013020985A1 (en) | 2011-08-10 | 2013-02-14 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
WO2013026836A1 (en) | 2011-08-22 | 2013-02-28 | Bayer Intellectual Property Gmbh | Fungicide hydroximoyl-tetrazole derivatives |
WO2013034621A1 (en) | 2011-09-09 | 2013-03-14 | Bayer Intellectual Property Gmbh | Acyl-homoserine lactone derivatives for improving plant yield |
WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
WO2013041602A1 (en) | 2011-09-23 | 2013-03-28 | Bayer Intellectual Property Gmbh | Use of 4-substituted 1-phenyl-pyrazole-3-carboxylic-acid derivatives as agents against abiotic plant stress |
WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
WO2013050324A1 (en) | 2011-10-06 | 2013-04-11 | Bayer Intellectual Property Gmbh | Combination, containing 4-phenylbutyric acid (4-pba) or a salt thereof (component (a)) and one or more selected additional agronomically active compounds (component(s) (b)), that reduces abiotic plant stress |
WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
US8487118B2 (en) | 2009-01-19 | 2013-07-16 | Bayer Cropscience Ag | Cyclic diones and their use as insecticides, acaricides and/or fungicides |
US8519003B2 (en) | 2007-03-12 | 2013-08-27 | Bayer Cropscience Ag | Phenoxyphenylamidines as fungicides |
WO2013124275A1 (en) | 2012-02-22 | 2013-08-29 | Bayer Cropscience Ag | Use of succinate dehydrogenase inhibitors (sdhis) for controlling wood diseases in grape. |
WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
WO2014009322A1 (en) | 2012-07-11 | 2014-01-16 | Bayer Cropscience Ag | Use of fungicidal combinations for increasing the tolerance of a plant towards abiotic stress |
WO2014037340A1 (en) | 2012-09-05 | 2014-03-13 | Bayer Cropscience Ag | Use of substituted 2-amidobenzimidazoles, 2-amidobenzoxazoles and 2-amidobenzothiazoles or salts thereof as active substances against abiotic plant stress |
WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
EP2740356A1 (en) | 2012-12-05 | 2014-06-11 | Bayer CropScience AG | Substituted (2Z)-5(1-Hydroxycyclohexyl)pent-2-en-4-inic acid derivatives |
EP2740720A1 (en) | 2012-12-05 | 2014-06-11 | Bayer CropScience AG | Substituted bicyclic and tricyclic pent-2-en-4-inic acid derivatives and their use for enhancing the stress tolerance in plants |
WO2014086751A1 (en) | 2012-12-05 | 2014-06-12 | Bayer Cropscience Ag | Use of substituted 1-(aryl ethynyl)-, 1-(heteroaryl ethynyl)-, 1-(heterocyclyl ethynyl)- and 1-(cyloalkenyl ethynyl)-cyclohexanols as active agents against abiotic plant stress |
WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
US8828906B2 (en) | 2009-03-25 | 2014-09-09 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
US8828907B2 (en) | 2009-03-25 | 2014-09-09 | Bayer Cropscience Ag | Active ingredient combinations having insecticidal and acaricidal properties |
WO2014135608A1 (en) | 2013-03-07 | 2014-09-12 | Bayer Cropscience Ag | Fungicidal 3-{phenyl[(heterocyclylmethoxy)imino]methyl}-heterocycle derivatives |
US8835657B2 (en) | 2009-05-06 | 2014-09-16 | Bayer Cropscience Ag | Cyclopentanedione compounds and their use as insecticides, acaricides and/or fungicides |
US8846568B2 (en) | 2009-03-25 | 2014-09-30 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
US8846567B2 (en) | 2009-03-25 | 2014-09-30 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
WO2014167008A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazolinthione derivatives |
WO2014167009A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazole derivatives |
WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
US8927583B2 (en) | 2006-12-22 | 2015-01-06 | Bayer Cropscience Ag | Pesticidal composition comprising a 2-pyrdilmethylbenzamide derivative and an insecticide compound |
WO2015004040A1 (en) | 2013-07-09 | 2015-01-15 | Bayer Cropscience Ag | Use of selected pyridone carboxamides or salts thereof as active substances against abiotic plant stress |
EP2837287A1 (en) | 2013-08-15 | 2015-02-18 | Bayer CropScience AG | Use of prothioconazole for increasing root growth of Brassicaceae |
WO2015032692A1 (en) | 2013-09-03 | 2015-03-12 | Bayer Cropscience Ag | Use of fungicidal agents for controlling chalara fraxinea on ash trees |
US9012360B2 (en) | 2009-03-25 | 2015-04-21 | Bayer Intellectual Property Gmbh | Synergistic combinations of active ingredients |
EP2865265A1 (en) | 2014-02-13 | 2015-04-29 | Bayer CropScience AG | Active compound combinations comprising phenylamidine compounds and biological control agents |
EP2865267A1 (en) | 2014-02-13 | 2015-04-29 | Bayer CropScience AG | Active compound combinations comprising phenylamidine compounds and biological control agents |
WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
US9199922B2 (en) | 2007-03-12 | 2015-12-01 | Bayer Intellectual Property Gmbh | Dihalophenoxyphenylamidines and use thereof as fungicides |
US9232794B2 (en) | 2009-06-02 | 2016-01-12 | Bayer Intellectual Property Gmbh | Use of succinate dehydrogenase inhibitors for controlling Sclerotinia ssp |
WO2016012362A1 (en) | 2014-07-22 | 2016-01-28 | Bayer Cropscience Aktiengesellschaft | Substituted cyano cycloalkyl penta-2,4-dienes, cyano cycloalkyl pent-2-en-4-ynes, cyano heterocyclyl penta-2,4-dienes and cyano heterocyclyl pent-2-en-4-ynes as active substances against abiotic plant stress |
EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
EP3000809A1 (en) | 2009-05-15 | 2016-03-30 | Bayer Intellectual Property GmbH | Fungicide pyrazole carboxamides derivatives |
WO2016096942A1 (en) | 2014-12-18 | 2016-06-23 | Bayer Cropscience Aktiengesellschaft | Use of selected pyridone carboxamides or salts thereof as active substances against abiotic plant stress |
WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
WO2017174430A1 (en) | 2016-04-06 | 2017-10-12 | Bayer Cropscience Aktiengesellschaft | Combination of nuclear polyhedrosis virus and diamides |
WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
WO2018054832A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives |
WO2018054829A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives and their use as fungicides |
WO2018077711A2 (en) | 2016-10-26 | 2018-05-03 | Bayer Cropscience Aktiengesellschaft | Use of pyraziflumid for controlling sclerotinia spp in seed treatment applications |
EP3332645A1 (en) | 2016-12-12 | 2018-06-13 | Bayer Cropscience AG | Use of substituted pyrimidine diones or their salts as agents to combat abiotic plant stress |
WO2018104392A1 (en) | 2016-12-08 | 2018-06-14 | Bayer Cropscience Aktiengesellschaft | Use of insecticides for controlling wireworms |
WO2018108627A1 (en) | 2016-12-12 | 2018-06-21 | Bayer Cropscience Aktiengesellschaft | Use of substituted indolinylmethyl sulfonamides, or the salts thereof for increasing the stress tolerance of plants |
DE102007045920B4 (en) | 2007-09-26 | 2018-07-05 | Bayer Intellectual Property Gmbh | Synergistic drug combinations |
WO2019025153A1 (en) | 2017-07-31 | 2019-02-07 | Bayer Cropscience Aktiengesellschaft | Use of substituted n-sulfonyl-n'-aryl diaminoalkanes and n-sulfonyl-n'-heteroaryl diaminoalkanes or salts thereof for increasing the stress tolerance in plants |
WO2019233863A1 (en) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbicidally active bicyclic benzoylpyrazoles |
WO2020020895A1 (en) | 2018-07-26 | 2020-01-30 | Bayer Aktiengesellschaft | Use of the succinate dehydrogenase inhibitor fluopyram for controlling root rot complex and/or seedling disease complex caused by rhizoctonia solani, fusarium species and pythium species in brassicaceae species |
WO2020057939A1 (en) | 2018-09-17 | 2020-03-26 | Bayer Aktiengesellschaft | Use of the fungicide isoflucypram for controlling claviceps purpurea and reducing sclerotia in cereals |
WO2020058144A1 (en) | 2018-09-17 | 2020-03-26 | Bayer Aktiengesellschaft | Use of the succinate dehydrogenase inhibitor fluopyram for controlling claviceps purpurea and reducing sclerotia in cereals |
WO2022140762A1 (en) | 2020-12-21 | 2022-06-30 | BASF Agricultural Solutions Seed US LLC | Brassica napus plants comprising an improved fertility restorer |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1969931A1 (en) * | 2007-03-12 | 2008-09-17 | Bayer CropScience Aktiengesellschaft | Fluoroalkyl phenylamidines and their use as fungicides |
EP1969934A1 (en) | 2007-03-12 | 2008-09-17 | Bayer CropScience AG | 4-cycloalkyl or 4-aryl substituted phenoxy phenylamidines and their use as fungicides |
JP2010524869A (en) | 2007-04-19 | 2010-07-22 | バイエル・クロツプサイエンス・アクチエンゲゼルシヤフト | Thiadiazolyloxyphenylamidines and their use as fungicides |
EP2016821A1 (en) | 2007-06-13 | 2009-01-21 | Syngeta Participations AG | New hybrid system for Brassica napus |
AU2009212420B2 (en) * | 2008-02-06 | 2014-07-03 | Pioneer Hi-Bred International, Inc. | New brassica ogura restorer lines with shortened Raphanus fragment (SRF) |
CN105830906B (en) * | 2015-12-15 | 2019-01-08 | 山东省农作物种质资源中心 | A kind of Ogura type radish male sterile cytoplasm and its selection |
CN106613898A (en) * | 2016-09-21 | 2017-05-10 | 韶关学院 | Breeding method of Wuta-tsai cytoplasmic male sterile line and maintainer line |
CN106967803B (en) * | 2017-03-21 | 2020-09-29 | 北京市农林科学院 | High-throughput molecular marker for detecting fertility restorer gene of radish Ogura-CMS (fertility restorer gene) and application of high-throughput molecular marker |
CN107593426B (en) * | 2017-09-27 | 2019-12-10 | 上海市农业科学院 | Breeding method of brassica napus dominant genic male sterility restoring line |
CN112259164B (en) * | 2020-10-28 | 2022-07-05 | 湖南省作物研究所 | Development method of competitive INDEL molecular marker for co-separation of radish cytoplasmic sterility restorer line |
CN113355453B (en) * | 2021-08-09 | 2021-10-29 | 华智生物技术有限公司 | Cabbage type rape radish cytoplasm sterility restoring geneRfoSNP molecular marker and application thereof |
CN116042889B (en) * | 2022-09-29 | 2023-08-29 | 安徽科技学院 | Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2193938A1 (en) * | 1996-12-24 | 1998-06-24 | David G. Charne | Oilseed brassica containing an improved fertility restorer gene for ogura cytoplasmic male sterility |
-
2003
- 2003-12-08 EP EP03293057A patent/EP1493328A1/en not_active Withdrawn
-
2004
- 2004-07-05 DK DK10183322.6T patent/DK2298066T3/en active
- 2004-07-05 SI SI200432233T patent/SI2298066T1/en unknown
- 2004-07-05 RU RU2006103259/13A patent/RU2373698C2/en active
- 2004-07-05 PL PL10183322T patent/PL2298066T3/en unknown
- 2004-07-05 PT PT91759985T patent/PT2179643E/en unknown
- 2004-07-05 EP EP10183322.6A patent/EP2298066B1/en active Active
- 2004-07-05 EP EP09175998A patent/EP2179643B1/en active Active
- 2004-07-05 US US10/563,277 patent/US7812217B2/en active Active
- 2004-07-05 CN CN2004800190566A patent/CN1816276B/en active Active
- 2004-07-05 ES ES09175998T patent/ES2394990T3/en active Active
- 2004-07-05 PT PT101833226T patent/PT2298066E/en unknown
- 2004-07-05 CA CA2531051A patent/CA2531051C/en active Active
- 2004-07-05 SI SI200431953T patent/SI2179643T1/en unknown
- 2004-07-05 PL PL09175998T patent/PL2179643T3/en unknown
- 2004-07-05 WO PCT/IB2004/002491 patent/WO2005002324A2/en active Application Filing
- 2004-07-05 AU AU2004253363A patent/AU2004253363A1/en not_active Abandoned
- 2004-07-05 ES ES10183322.6T patent/ES2532641T3/en active Active
- 2004-07-05 EP EP04744142A patent/EP1641336A2/en not_active Ceased
- 2004-07-05 DK DK09175998.5T patent/DK2179643T3/en active
-
2007
- 2007-02-09 HK HK07101597.8A patent/HK1094409A1/en not_active IP Right Cessation
-
2010
- 2010-01-22 AU AU2010200255A patent/AU2010200255B2/en active Active
- 2010-06-15 US US12/815,921 patent/US8097776B2/en active Active
-
2015
- 2015-03-27 CY CY20151100306T patent/CY1116159T1/en unknown
Non-Patent Citations (6)
Title |
---|
BELLAOUI M ET AL: "The restorer Rfo gene acts post-translationally on the stability of the ORF138 Ogura CMS-associated protein in reproductive tissues of rapeseed cybrids" PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 40, no. 5, July 1999 (1999-07), pages 893-902, XP002227975 ISSN: 0167-4412 * |
DELOURME R ET AL: "Characterisation of the radish introgression carrying the Rfo restorer gene for the Ogu-INRA cytoplasmic male sterility in rapeseed (Brassica napus L.)" THEORETICAL AND APPLIED GENETICS, vol. 97, no. 1-2, July 1998 (1998-07), pages 129-134, XP002283532 ISSN: 0040-5752 cited in the application * |
DELOURME R ET AL: "IDENTIFICATION OF RAPD MARKERS LINKED TO A FERTILITY RESTORER GENE FOR THE OGURA RADISH CYTOPLASMIC MALE STERILITY OF RAPESEED (BRASSICA NAPUS L.)" THEORETICAL AND APPLIED GENETICS, SPRINGER, BERLIN, DE, vol. 88, no. 6/7, 1994, pages 741-748, XP002043620 ISSN: 0040-5752 * |
DELOURME R ET AL: "LINKAGE BETWEEN AN ISOZYME MARKER AND A RESTORER GENE IN RADISH CYTOPLASMIC MALE STERILITY OF RAPESEED (BRASSICA NAPUS L.)" THEORETICAL AND APPLIED GENETICS, SPRINGER, BERLIN, DE, vol. 85, 1992, pages 222-228, XP002943129 ISSN: 0040-5752 cited in the application * |
DESLOIRE SOPHIE ET AL: "Identification of the fertility restoration locus, Rfo, in radish, as a member of the pentatricopeptide-repeat protein family." EMBO REPORTS, vol. 4, no. 6, June 2003 (2003-06), pages 588-594, XP002283531 ISSN: 1469-221X (ISSN print) * |
GIANCOLA SANDRA ET AL: "Characterization of a radish introgression carrying the Ogura fertility restorer gene Rfo in rapeseed, using the Arabidopsis genome sequence and radish genetic mapping." TAG. THEORETICAL AND APPLIED GENETICS. THEORETISCHE UND ANGEWANDTE GENETIK. GERMANY NOV 2003, vol. 107, no. 8, 27 August 2003 (2003-08-27), pages 1442-1451, XP002283533 ISSN: 0040-5752 * |
Cited By (201)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8927583B2 (en) | 2006-12-22 | 2015-01-06 | Bayer Cropscience Ag | Pesticidal composition comprising a 2-pyrdilmethylbenzamide derivative and an insecticide compound |
US8288426B2 (en) | 2006-12-22 | 2012-10-16 | Bayer Cropscience Ag | Pesticidal composition comprising fenamidone and an insecticide compound |
US8785692B2 (en) | 2007-03-12 | 2014-07-22 | Bayer Cropscience Ag | Substituted phenylamidines and the use thereof as fungicides |
US8519003B2 (en) | 2007-03-12 | 2013-08-27 | Bayer Cropscience Ag | Phenoxyphenylamidines as fungicides |
US8080688B2 (en) | 2007-03-12 | 2011-12-20 | Bayer Cropscience Ag | 3, 4-disubstituted phenoxyphenylamidines and use thereof as fungicides |
US9199922B2 (en) | 2007-03-12 | 2015-12-01 | Bayer Intellectual Property Gmbh | Dihalophenoxyphenylamidines and use thereof as fungicides |
US8334237B2 (en) | 2007-03-12 | 2012-12-18 | Bayer Cropscience Ag | Substituted phenylamidines and the use thereof as fungicides |
DE102007045953A1 (en) | 2007-09-26 | 2009-04-02 | Bayer Cropscience Ag | Active substance combination, useful for combating animal pest, treating seed, transgenic plant and seeds of transgenic plant, comprises a 5H-furan-2-one compound and other active agent comprising e.g. acrinathrin and alpha-cypermethrin |
DE102007045955A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. for combating animal pests and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. diazinon, isoxathion, carbofuran or aldicarb |
DE102007045919A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. to combat animal pest and to prepare insecticidal and acaricidal agent, comprises a substituted 5H-furan-2-one compound and a compound e.g. spirotetramat, spirodiclofen and spiromesifen |
US8455480B2 (en) | 2007-09-26 | 2013-06-04 | Bayer Cropscience Ag | Active agent combinations having insecticidal and acaricidal properties |
DE102007045920B4 (en) | 2007-09-26 | 2018-07-05 | Bayer Intellectual Property Gmbh | Synergistic drug combinations |
DE102007045956A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Combination of active ingredients with insecticidal and acaricidal properties |
DE102007045957A1 (en) | 2007-09-26 | 2009-04-09 | Bayer Cropscience Ag | Active agent combination, useful e.g. for combating animal pests e.g. insects and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. benzoyl urea, buprofezin and cyromazine |
DE102007045953B4 (en) | 2007-09-26 | 2018-07-05 | Bayer Intellectual Property Gmbh | Drug combinations with insecticidal and acaricidal properties |
DE102007045922A1 (en) | 2007-09-26 | 2009-04-02 | Bayer Cropscience Ag | Drug combinations with insecticidal and acaricidal properties |
DE102007045919B4 (en) | 2007-09-26 | 2018-07-05 | Bayer Intellectual Property Gmbh | Drug combinations with insecticidal and acaricidal properties |
EP2072506A1 (en) | 2007-12-21 | 2009-06-24 | Bayer CropScience AG | Thiazolyloxyphenylamidine or thiadiazolyloxyphenylamidine und its use as fungicide |
EP2090168A1 (en) | 2008-02-12 | 2009-08-19 | Bayer CropScience AG | Method for improving plant growth |
EP2168434A1 (en) | 2008-08-02 | 2010-03-31 | Bayer CropScience AG | Use of azols to increase resistance of plants of parts of plants to abiotic stress |
EP2374791A1 (en) | 2008-08-14 | 2011-10-12 | Bayer CropScience Aktiengesellschaft | Insecticidal 4-phenyl-1H pyrazoles |
DE102008041695A1 (en) | 2008-08-29 | 2010-03-04 | Bayer Cropscience Ag | Methods for improving plant growth |
EP2201838A1 (en) | 2008-12-05 | 2010-06-30 | Bayer CropScience AG | Active ingredient-beneficial organism combinations with insecticide and acaricide properties |
EP2198709A1 (en) | 2008-12-19 | 2010-06-23 | Bayer CropScience AG | Method for treating resistant animal pests |
WO2010075994A1 (en) | 2008-12-29 | 2010-07-08 | Bayer Cropscience Aktiengesellschaft | Treatment of transgenic crops with mixtures of fiproles and chloronicotinyls |
EP2204094A1 (en) | 2008-12-29 | 2010-07-07 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants Introduction |
EP2039771A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
EP2039772A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants introduction |
EP2039770A2 (en) | 2009-01-06 | 2009-03-25 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
US8487118B2 (en) | 2009-01-19 | 2013-07-16 | Bayer Cropscience Ag | Cyclic diones and their use as insecticides, acaricides and/or fungicides |
EP2227951A1 (en) | 2009-01-23 | 2010-09-15 | Bayer CropScience AG | Application of enaminocarbonyl compounds for combating viruses transmitted by insects |
WO2010083955A2 (en) | 2009-01-23 | 2010-07-29 | Bayer Cropscience Aktiengesellschaft | Use of enaminocarboxylic compounds for fighting viruses transmitted by insects |
WO2010086311A1 (en) | 2009-01-28 | 2010-08-05 | Bayer Cropscience Ag | Fungicide n-cycloalkyl-n-bicyclicmethylene-carboxamide derivatives |
WO2010086095A1 (en) | 2009-01-29 | 2010-08-05 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants introduction |
EP2218717A1 (en) | 2009-02-17 | 2010-08-18 | Bayer CropScience AG | Fungicidal N-((HET)Arylethyl)thiocarboxamide derivatives |
WO2010094666A2 (en) | 2009-02-17 | 2010-08-26 | Bayer Cropscience Ag | Fungicidal n-(phenylcycloalkyl)carboxamide, n-(benzylcycloalkyl)carboxamide and thiocarboxamide derivatives |
WO2010094728A1 (en) | 2009-02-19 | 2010-08-26 | Bayer Cropscience Ag | Pesticide composition comprising a tetrazolyloxime derivative and a fungicide or an insecticide active substance |
DE102009001469A1 (en) | 2009-03-11 | 2009-09-24 | Bayer Cropscience Ag | Improving utilization of productive potential of transgenic plant by controlling e.g. animal pest, and/or by improving plant health, comprises treating the transgenic plant with active agent composition comprising prothioconazole |
DE102009001681A1 (en) | 2009-03-20 | 2010-09-23 | Bayer Cropscience Ag | Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi, microorganisms and/or improving plant health, comprises treating plant with a drug composition comprising iprovalicarb |
DE102009001732A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising trifloxystrobin |
DE102009001730A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi and/or microorganisms and/or the plant health, comprises treating plant with a drug composition comprising spiroxamine |
DE102009001728A1 (en) | 2009-03-23 | 2010-09-30 | Bayer Cropscience Ag | Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising fluoxastrobin |
US8846567B2 (en) | 2009-03-25 | 2014-09-30 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
US9012360B2 (en) | 2009-03-25 | 2015-04-21 | Bayer Intellectual Property Gmbh | Synergistic combinations of active ingredients |
US8828906B2 (en) | 2009-03-25 | 2014-09-09 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
US8828907B2 (en) | 2009-03-25 | 2014-09-09 | Bayer Cropscience Ag | Active ingredient combinations having insecticidal and acaricidal properties |
EP2232995A1 (en) | 2009-03-25 | 2010-09-29 | Bayer CropScience AG | Method for improved utilisation of the production potential of transgenic plants |
US8846568B2 (en) | 2009-03-25 | 2014-09-30 | Bayer Cropscience Ag | Active compound combinations having insecticidal and acaricidal properties |
EP2239331A1 (en) | 2009-04-07 | 2010-10-13 | Bayer CropScience AG | Method for improved utilization of the production potential of transgenic plants |
US8835657B2 (en) | 2009-05-06 | 2014-09-16 | Bayer Cropscience Ag | Cyclopentanedione compounds and their use as insecticides, acaricides and/or fungicides |
EP3000809A1 (en) | 2009-05-15 | 2016-03-30 | Bayer Intellectual Property GmbH | Fungicide pyrazole carboxamides derivatives |
EP2251331A1 (en) | 2009-05-15 | 2010-11-17 | Bayer CropScience AG | Fungicide pyrazole carboxamides derivatives |
EP2255626A1 (en) | 2009-05-27 | 2010-12-01 | Bayer CropScience AG | Use of succinate dehydrogenase inhibitors to increase resistance of plants or parts of plants to abiotic stress |
US9877482B2 (en) | 2009-06-02 | 2018-01-30 | Bayer Intellectual Property Gmbh | Use of succinate dehydrogenase inhibitors for controlling Sclerotinia ssp |
US9232794B2 (en) | 2009-06-02 | 2016-01-12 | Bayer Intellectual Property Gmbh | Use of succinate dehydrogenase inhibitors for controlling Sclerotinia ssp |
WO2011006603A2 (en) | 2009-07-16 | 2011-01-20 | Bayer Cropscience Ag | Synergistic active substance combinations containing phenyl triazoles |
WO2011020698A1 (en) | 2009-08-03 | 2011-02-24 | Nickerson International Research | Brassica plant for restoring fertility in an ogura cytoplasmic male-sterility system, method for producing same, and use of said plant |
WO2011015524A2 (en) | 2009-08-03 | 2011-02-10 | Bayer Cropscience Ag | Fungicide heterocycles derivatives |
EP2292094A1 (en) | 2009-09-02 | 2011-03-09 | Bayer CropScience AG | Active compound combinations |
WO2011035834A1 (en) | 2009-09-02 | 2011-03-31 | Bayer Cropscience Ag | Active compound combinations |
EP2343280A1 (en) | 2009-12-10 | 2011-07-13 | Bayer CropScience AG | Fungicide quinoline derivatives |
WO2011080254A2 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
WO2011080256A1 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011080255A2 (en) | 2009-12-28 | 2011-07-07 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011089071A2 (en) | 2010-01-22 | 2011-07-28 | Bayer Cropscience Ag | Acaricide and/or insecticide active substance combinations |
US8722072B2 (en) | 2010-01-22 | 2014-05-13 | Bayer Intellectual Property Gmbh | Acaricidal and/or insecticidal active ingredient combinations |
EP2353387A1 (en) | 2010-02-05 | 2011-08-10 | Bayer CropScience AG | Use of succinate dehydrogenase (SDH) inhibitors in the treatment of plant types in the sweet grass family |
WO2011095496A2 (en) | 2010-02-05 | 2011-08-11 | Bayer Cropscience Ag | Use of succinate dehydrogenase (sdh) inhibitors in treating plant species of the family of true grasses |
US9215872B2 (en) | 2010-02-05 | 2015-12-22 | Bayer Intellectual Property Gmbh | Use of succinate dehydrogenase (SDH) inhibitors in the treatment of plant species from the family of the true grasses |
WO2011107504A1 (en) | 2010-03-04 | 2011-09-09 | Bayer Cropscience Ag | Fluoroalkyl-substituted 2-amidobenzimidazoles and the use thereof for boosting stress tolerance in plants |
WO2011113861A2 (en) | 2010-03-18 | 2011-09-22 | Bayer Cropscience Ag | Aryl and hetaryl sulfonamides as active agents against abiotic plant stress |
WO2011124554A2 (en) | 2010-04-06 | 2011-10-13 | Bayer Cropscience Ag | Use of 4-phenylbutyric acid and/or the salts thereof for enhancing the stress tolerance of plants |
WO2011124553A2 (en) | 2010-04-09 | 2011-10-13 | Bayer Cropscience Ag | Use of derivatives of the (1-cyanocyclopropyl)phenylphosphinic acid, the esters thereof and/or the salts thereof for enhancing the tolerance of plants to abiotic stress |
EP2377397A1 (en) | 2010-04-14 | 2011-10-19 | Bayer CropScience AG | Use of fungicidal agents for controlling mycoses in palm trees |
WO2011128262A2 (en) | 2010-04-14 | 2011-10-20 | Bayer Cropscience Ag | Use of fungicidal agents for controlling mycoses on palms |
WO2011134912A1 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
WO2011134911A2 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2011134913A1 (en) | 2010-04-28 | 2011-11-03 | Bayer Cropscience Ag | Fungicide hydroximoyl-heterocycles derivatives |
WO2011151368A2 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2011151370A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylalkyl)] pyrazole (thio)carboxamides and their heterosubstituted analogues |
WO2011151369A1 (en) | 2010-06-03 | 2011-12-08 | Bayer Cropscience Ag | N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues |
WO2012004221A2 (en) | 2010-07-07 | 2012-01-12 | Bayer Cropscience Ag | Anthranilamides in combination with fungicides |
WO2012010525A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Use of anthranilic acid amide derivatives for controlling insects and spider mites by watering, mixing with soil, drench treatment, droplet application, injection into the soil, stems or blossoms, in hydroponic systems, by treating the planting hole or immersion application, floating or seed box application or by the treatment of seeds, and for increasing the stress tolerance in plants to abiotic stress |
WO2012010579A2 (en) | 2010-07-20 | 2012-01-26 | Bayer Cropscience Ag | Benzocycloalkenes as antifungal agents |
WO2012028578A1 (en) | 2010-09-03 | 2012-03-08 | Bayer Cropscience Ag | Substituted fused pyrimidinones and dihydropyrimidinones |
WO2012038476A1 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of active ingredients for controlling nematodes in nematode-resistant crops |
WO2012038480A2 (en) | 2010-09-22 | 2012-03-29 | Bayer Cropscience Ag | Use of biological or chemical control agents for controlling insects and nematodes in resistant crops |
WO2012045798A1 (en) | 2010-10-07 | 2012-04-12 | Bayer Cropscience Ag | Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative |
WO2012052490A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | N-benzyl heterocyclic carboxamides |
WO2012052489A1 (en) | 2010-10-21 | 2012-04-26 | Bayer Cropscience Ag | 1-(heterocyclic carbonyl) piperidines |
WO2012059497A1 (en) | 2010-11-02 | 2012-05-10 | Bayer Cropscience Ag | N-hetarylmethyl pyrazolylcarboxamides |
US9206137B2 (en) | 2010-11-15 | 2015-12-08 | Bayer Intellectual Property Gmbh | N-Aryl pyrazole(thio)carboxamides |
WO2012065945A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazole(thio)carboxamides |
WO2012065947A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | 5-halogenopyrazolecarboxamides |
WO2012065944A1 (en) | 2010-11-15 | 2012-05-24 | Bayer Cropscience Ag | N-aryl pyrazole(thio)carboxamides |
EP3103338A1 (en) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Agent combinations comprising pyridylethyl benzamides and other agents |
EP2460407A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Agent combinations comprising pyridylethyl benzamides and other agents |
EP2460406A1 (en) | 2010-12-01 | 2012-06-06 | Bayer CropScience AG | Use of fluopyram for controlling nematodes in nematode resistant crops |
WO2012072696A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Active ingredient combinations comprising pyridylethylbenzamides and other active ingredients |
EP3103334A1 (en) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Agent combinations comprising pyridylethyl benzamides and other agents |
EP3103339A1 (en) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Agent combinations comprising pyridylethyl benzamides and other agents |
EP3103340A1 (en) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Agent combinations comprising pyridylethyl benzamides and other agents |
EP3092900A1 (en) | 2010-12-01 | 2016-11-16 | Bayer Intellectual Property GmbH | Active ingredient combinations comprising pyridylethylbenzamides and other active ingredients |
WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
EP2474542A1 (en) | 2010-12-29 | 2012-07-11 | Bayer CropScience AG | Fungicide hydroximoyl-tetrazole derivatives |
WO2012089757A1 (en) | 2010-12-29 | 2012-07-05 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012089721A1 (en) | 2010-12-30 | 2012-07-05 | Bayer Cropscience Ag | Use of substituted spirocyclic sulfonamidocarboxylic acids, carboxylic esters thereof, carboxamides thereof and carbonitriles thereof or salts thereof for enhancement of stress tolerance in plants |
WO2012089722A2 (en) | 2010-12-30 | 2012-07-05 | Bayer Cropscience Ag | Use of open-chain carboxylic acids, carbonic esters, carboxamides and carbonitriles of aryl, heteroaryl and benzylsulfonamide or the salts thereof for improving the stress tolerance in plants |
EP2494867A1 (en) | 2011-03-01 | 2012-09-05 | Bayer CropScience AG | Halogen-substituted compounds in combination with fungicides |
WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
WO2012123434A1 (en) | 2011-03-14 | 2012-09-20 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012136581A1 (en) | 2011-04-08 | 2012-10-11 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012139890A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted 5-(cyclohex-2-en-1-yl)-penta-2,4-dienes and 5-(cyclohex-2-en-1-yl)-pent-2-en-4-ines as active agents against abiotic stress in plants |
EP2511255A1 (en) | 2011-04-15 | 2012-10-17 | Bayer CropScience AG | Substituted prop-2-in-1-ol and prop-2-en-1-ol derivatives |
WO2012139892A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted 5-(bicyclo[4.1.0]hept-3-en-2-yl)-penta-2,4-dienes and 5-(bicyclo[4.1.0]hept-3-en-2-yl)-pent-2-ene-4-ines as active agents against abiotic stress in plants |
WO2012139891A1 (en) | 2011-04-15 | 2012-10-18 | Bayer Cropscience Ag | Substituted vinyl and alkinyl cyclohexenols as active agents against abiotic stress in plants |
EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
WO2013004652A1 (en) | 2011-07-04 | 2013-01-10 | Bayer Intellectual Property Gmbh | Use of substituted isoquinolinones, isoquinolindiones, isoquinolintriones and dihydroisoquinolinones or in each case salts thereof as active agents against abiotic stress in plants |
US9265252B2 (en) | 2011-08-10 | 2016-02-23 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
WO2013020985A1 (en) | 2011-08-10 | 2013-02-14 | Bayer Intellectual Property Gmbh | Active compound combinations comprising specific tetramic acid derivatives |
WO2013026836A1 (en) | 2011-08-22 | 2013-02-28 | Bayer Intellectual Property Gmbh | Fungicide hydroximoyl-tetrazole derivatives |
EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
WO2013034621A1 (en) | 2011-09-09 | 2013-03-14 | Bayer Intellectual Property Gmbh | Acyl-homoserine lactone derivatives for improving plant yield |
WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
WO2013041602A1 (en) | 2011-09-23 | 2013-03-28 | Bayer Intellectual Property Gmbh | Use of 4-substituted 1-phenyl-pyrazole-3-carboxylic-acid derivatives as agents against abiotic plant stress |
WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
WO2013050324A1 (en) | 2011-10-06 | 2013-04-11 | Bayer Intellectual Property Gmbh | Combination, containing 4-phenylbutyric acid (4-pba) or a salt thereof (component (a)) and one or more selected additional agronomically active compounds (component(s) (b)), that reduces abiotic plant stress |
WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013124275A1 (en) | 2012-02-22 | 2013-08-29 | Bayer Cropscience Ag | Use of succinate dehydrogenase inhibitors (sdhis) for controlling wood diseases in grape. |
WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
WO2014009322A1 (en) | 2012-07-11 | 2014-01-16 | Bayer Cropscience Ag | Use of fungicidal combinations for increasing the tolerance of a plant towards abiotic stress |
WO2014037340A1 (en) | 2012-09-05 | 2014-03-13 | Bayer Cropscience Ag | Use of substituted 2-amidobenzimidazoles, 2-amidobenzoxazoles and 2-amidobenzothiazoles or salts thereof as active substances against abiotic plant stress |
WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
WO2014079789A1 (en) | 2012-11-23 | 2014-05-30 | Bayer Cropscience Ag | Active compound combinations |
WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
EP2740720A1 (en) | 2012-12-05 | 2014-06-11 | Bayer CropScience AG | Substituted bicyclic and tricyclic pent-2-en-4-inic acid derivatives and their use for enhancing the stress tolerance in plants |
EP2740356A1 (en) | 2012-12-05 | 2014-06-11 | Bayer CropScience AG | Substituted (2Z)-5(1-Hydroxycyclohexyl)pent-2-en-4-inic acid derivatives |
WO2014086751A1 (en) | 2012-12-05 | 2014-06-12 | Bayer Cropscience Ag | Use of substituted 1-(aryl ethynyl)-, 1-(heteroaryl ethynyl)-, 1-(heterocyclyl ethynyl)- and 1-(cyloalkenyl ethynyl)-cyclohexanols as active agents against abiotic plant stress |
WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
WO2014135608A1 (en) | 2013-03-07 | 2014-09-12 | Bayer Cropscience Ag | Fungicidal 3-{phenyl[(heterocyclylmethoxy)imino]methyl}-heterocycle derivatives |
WO2014167008A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazolinthione derivatives |
WO2014167009A1 (en) | 2013-04-12 | 2014-10-16 | Bayer Cropscience Ag | Novel triazole derivatives |
WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
WO2015004040A1 (en) | 2013-07-09 | 2015-01-15 | Bayer Cropscience Ag | Use of selected pyridone carboxamides or salts thereof as active substances against abiotic plant stress |
EP2837287A1 (en) | 2013-08-15 | 2015-02-18 | Bayer CropScience AG | Use of prothioconazole for increasing root growth of Brassicaceae |
WO2015032692A1 (en) | 2013-09-03 | 2015-03-12 | Bayer Cropscience Ag | Use of fungicidal agents for controlling chalara fraxinea on ash trees |
WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
EP2865265A1 (en) | 2014-02-13 | 2015-04-29 | Bayer CropScience AG | Active compound combinations comprising phenylamidine compounds and biological control agents |
EP2865267A1 (en) | 2014-02-13 | 2015-04-29 | Bayer CropScience AG | Active compound combinations comprising phenylamidine compounds and biological control agents |
WO2016012362A1 (en) | 2014-07-22 | 2016-01-28 | Bayer Cropscience Aktiengesellschaft | Substituted cyano cycloalkyl penta-2,4-dienes, cyano cycloalkyl pent-2-en-4-ynes, cyano heterocyclyl penta-2,4-dienes and cyano heterocyclyl pent-2-en-4-ynes as active substances against abiotic plant stress |
WO2016096942A1 (en) | 2014-12-18 | 2016-06-23 | Bayer Cropscience Aktiengesellschaft | Use of selected pyridone carboxamides or salts thereof as active substances against abiotic plant stress |
WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
WO2017174430A1 (en) | 2016-04-06 | 2017-10-12 | Bayer Cropscience Aktiengesellschaft | Combination of nuclear polyhedrosis virus and diamides |
WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
WO2018054832A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives |
WO2018054829A1 (en) | 2016-09-22 | 2018-03-29 | Bayer Cropscience Aktiengesellschaft | Novel triazole derivatives and their use as fungicides |
WO2018077711A2 (en) | 2016-10-26 | 2018-05-03 | Bayer Cropscience Aktiengesellschaft | Use of pyraziflumid for controlling sclerotinia spp in seed treatment applications |
WO2018104392A1 (en) | 2016-12-08 | 2018-06-14 | Bayer Cropscience Aktiengesellschaft | Use of insecticides for controlling wireworms |
WO2018108627A1 (en) | 2016-12-12 | 2018-06-21 | Bayer Cropscience Aktiengesellschaft | Use of substituted indolinylmethyl sulfonamides, or the salts thereof for increasing the stress tolerance of plants |
EP3332645A1 (en) | 2016-12-12 | 2018-06-13 | Bayer Cropscience AG | Use of substituted pyrimidine diones or their salts as agents to combat abiotic plant stress |
WO2019025153A1 (en) | 2017-07-31 | 2019-02-07 | Bayer Cropscience Aktiengesellschaft | Use of substituted n-sulfonyl-n'-aryl diaminoalkanes and n-sulfonyl-n'-heteroaryl diaminoalkanes or salts thereof for increasing the stress tolerance in plants |
WO2019233863A1 (en) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbicidally active bicyclic benzoylpyrazoles |
WO2020020895A1 (en) | 2018-07-26 | 2020-01-30 | Bayer Aktiengesellschaft | Use of the succinate dehydrogenase inhibitor fluopyram for controlling root rot complex and/or seedling disease complex caused by rhizoctonia solani, fusarium species and pythium species in brassicaceae species |
WO2020057939A1 (en) | 2018-09-17 | 2020-03-26 | Bayer Aktiengesellschaft | Use of the fungicide isoflucypram for controlling claviceps purpurea and reducing sclerotia in cereals |
WO2020058144A1 (en) | 2018-09-17 | 2020-03-26 | Bayer Aktiengesellschaft | Use of the succinate dehydrogenase inhibitor fluopyram for controlling claviceps purpurea and reducing sclerotia in cereals |
WO2022140762A1 (en) | 2020-12-21 | 2022-06-30 | BASF Agricultural Solutions Seed US LLC | Brassica napus plants comprising an improved fertility restorer |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2531051C (en) | Method of producing double low restorer lines of brassica napus having a good agronomic value | |
Dadkhodaie et al. | Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36 | |
US10415101B2 (en) | Methods for producing canola plants with clubroot resistance and compositions thereof | |
CN103484556B (en) | Primer and method for detecting molecular marker of rice aroma allele | |
US20150089685A1 (en) | Novel maize plant | |
US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
BR112017023275B1 (en) | METHODS FOR SELECTING A BRACHITICA CORN PLANT OR SEED | |
Nieto‐Lopez et al. | Russian wheat aphid resistance in barley: inheritance and linked molecular markers | |
CN103118531A (en) | Xanthomonas campestris pv. campestris resistant brassica plant and preparation thereof | |
CA2484633A1 (en) | Identification of soybeans having resistance to phytophthora sojae | |
Schlegel | Hybrid breeding boosted molecular genetics in rye | |
Eid | Validation of SSR molecular markers linked to drought tolerant in some wheat cultivars | |
AU2014318041B2 (en) | Molecular markers for blackleg resistance gene Rlm2 in Brassica napus and methods of using the same | |
Kim | Identification of hypervariable chloroplast intergenic sequences in onion (Allium cepa L.) and their use in analysing the origins of male-sterile onion cytotypes | |
AU2014318042B2 (en) | Molecular markers for blackleg resistance gene Rlm4 in Brassica napus and methods of using the same | |
US20150167105A1 (en) | Genetic loci associated with gray leaf spot in maize | |
Primard-Brisset et al. | A new recombined double low restorer line for the Ogu-INRA cms in rapeseed |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200480019056.6 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2006516608 Country of ref document: JP |
|
ENP | Entry into the national phase |
Ref document number: 2531051 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004253363 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004744142 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2004253363 Country of ref document: AU Date of ref document: 20040705 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2004253363 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006103259 Country of ref document: RU |
|
WWP | Wipo information: published in national office |
Ref document number: 2004744142 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10563277 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 10563277 Country of ref document: US |