WO2005056002A2 - Use of inductors of the degradation pathway of gamma-butyrolactone for inactivating the homoserine lactone n-acyl signal of gram-negative pathogenic bacteria - Google Patents

Use of inductors of the degradation pathway of gamma-butyrolactone for inactivating the homoserine lactone n-acyl signal of gram-negative pathogenic bacteria Download PDF

Info

Publication number
WO2005056002A2
WO2005056002A2 PCT/FR2004/003116 FR2004003116W WO2005056002A2 WO 2005056002 A2 WO2005056002 A2 WO 2005056002A2 FR 2004003116 W FR2004003116 W FR 2004003116W WO 2005056002 A2 WO2005056002 A2 WO 2005056002A2
Authority
WO
WIPO (PCT)
Prior art keywords
butyrolactone
inducer
pathway
acyl
degradation pathway
Prior art date
Application number
PCT/FR2004/003116
Other languages
French (fr)
Other versions
WO2005056002A3 (en
Inventor
Denis Faure
Aurélien CARLIER
Yves Dessaux
Original Assignee
Centre National De La Recherche Scientifique
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National De La Recherche Scientifique filed Critical Centre National De La Recherche Scientifique
Publication of WO2005056002A2 publication Critical patent/WO2005056002A2/en
Publication of WO2005056002A3 publication Critical patent/WO2005056002A3/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N61/00—Biocides, pest repellants or attractants, or plant growth regulators containing substances of unknown or undetermined composition, e.g. substances characterised only by the mode of action
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/36—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/42—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing within the same carbon skeleton a carboxylic group or a thio analogue, or a derivative thereof, and a carbon atom having only two bonds to hetero atoms with at the most one bond to halogen, e.g. keto-carboxylic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
    • A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
    • A01N43/06—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom five-membered rings
    • A01N43/08—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom five-membered rings with oxygen as the ring hetero atom
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
    • A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
    • A23L3/3463—Organic compounds; Microorganisms; Enzymes
    • A23L3/3481—Organic compounds containing oxygen
    • A23L3/3508—Organic compounds containing oxygen containing carboxyl groups
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/191—Carboxylic acids, e.g. valproic acid having two or more hydroxy groups, e.g. gluconic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/194—Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid, pantothenic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/16—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using chemical substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material

Definitions

  • the present invention relates to the use of inducers of the ⁇ -butyrolactone degradation pathway to inactivate the signal.]
  • the present invention relates to the use of inducers of the ⁇ -butyrolactone degradation pathway.
  • N-acyl homoserine lactone produced by pathogenic bacteria and applications of these inducers as antibacterials, especially in the fields of agriculture, the food industry and human and animal medicine.
  • bacteria have developed a virulence control strategy by a mechanism of intercellular communication, dependent on the density of population, called quorums nsing. These bacteria are capable of producing, detecting and responding to small, self-inducing and diffusible molecules signa], called "quormones"; when the bacterial population reaches a sufficient density, the concentration of quormone exceeds a critical threshold and the expression of virulence genes is activated by the interaction of quormones with specific factors regulating transcription, thus allowing a synchronous, massive and efficient host.
  • the interruption of the signal of the quormones also called quorum quenching represents a new approach to identify new compounds which can be used as antibacterials both in the field of human and veterinary medicine (prevention and treatment of bacterial infections), as in that of agriculture (fight against plant pathogens), the agrifood industry (food preservation) and human and veterinary health (disinfection of equipment for medical use, industry], domestic, as well as the environment), (for a review see Camara et al., The Lancet, 2002, 2, 667-676 and Zhang et al., Trends in Plant Science, 2003, 8, 238-244).
  • N-acyl homoserine lactones are among the best known quormones in Gram-negative bacteria, in particular those belonging to the genera Burkholderia, E ⁇ -winia and Pseudomonas, responsible for the destruction of crops of plants of agronomic interest such as rice or potato, as well as nosocomial and opportunistic infections in humans.
  • the NAHLs consist of a lactone homoserine ring, linked via an amide bond to an acyl group of a C 4 -C carbon chain, saturated or unsaturated, optionally substituted at the carbon level in position 3 , by a hydroxyl or carbonyl group ( Figure 1 of Camara et al., cited above).
  • NAHL biosynthesis involves the synthesis of acyl-ACP (ACP for Acyl Carrier Protein) by the fatty acid synthesis pathway and the catalysis of the reaction between PAcyl-ACP and S-adenosylmethionine, by NAHL synthase.
  • acyl-ACP ACP for Acyl Carrier Protein
  • S-adenosylmethionine S-adenosylmethionine
  • the aiiA gene in Bacillus sp (Dong et al., PNAS, 2000, 97, 3526-3531) and its counterparts such as the atlM genes in Agrobacterium tumefaciens (Zhang et al., PNAS, 2002, 99, 4638-4643) and ahlD in Arthobacter sp. (Park et al., Microbiol, 2003, 149, 1541-1550), and the aiiD gene in Ralstonia sp. (Lin et al., Mol.
  • transgenic plants expressing exogenous lactonase encoded by the aiiA gene from Bacillus sp are more resistant to infection by pathogenic bacteria producing NAHL than unmodified plants.
  • this approach is cumbersome to implement since it involves the construction of transgenic plants or animals or the inoculation of recombinant vectors expressing a lactonase or an acyl as e.
  • Strategies' envisaged have so far failed to identify compounds capable of inactivating the HSL signal, which are specific, non-toxic and easy to implement. Consequently, the inventors have set themselves the goal of identifying such compounds.
  • the degradation pathway for ⁇ -butyrolactone involves three enzymes: (i) lactonase converts ⁇ -butyrolactone (GBL) to ⁇ -hydroxybutyrate (GHB), (ii) NAD-alcohol dehydrogenase oxidizes GHB to succinate semialdehyde (SSA) and (iii) NAD-SSA dehydrogenase oxidizes SSA to succinic acid (SA), a compound in the Krebs cycle. While SA and SSA are intermediaries of different metabolic pathways, common to eukaryotes and prokaryotes, GHB and GBL are rare in nature.
  • GHB is mainly described as a metabolic intermediate of GBL with psychotropic properties (Mason et al., Acad. Emerg. Med., 2003, 9, 730-739).
  • GBL is produced for industrial purposes and is found in plants and in fermented drinks such as wine (Lee et al. J. Agri. Food. Chem., 2000, 48, 4290-4293; Vose et al., J. Forensic Sc, 2000, 46, 1 164-1 167); it is also described as having antiparasitic properties against soil nematodes (American patent US 3,086,907).
  • the degradation pathway for ⁇ -butyrolactone has been demonstrated only in humans and rats but not in bacteria (Mason et al., Cited above).
  • the attM gene of A. tumefaciens belongs to the allKLM operon which, to date, is unique among the sequenced bacterial genomes; it codes for a lactonase which opens the ⁇ -butyrolactone cycle of NAHL and belongs to the family of zinc hydrolases (Zhang et al., cited above; Carlier A. et al, Appl. Env. Microbiol., 2003, 69, 4989-4993).
  • the function of the other genes of the attKLM operon has not been identified.
  • the attKLM operon is involved in the degradation and assimilation pathway for ⁇ -butyrolactone (GBL), ⁇ -hydroxybutyrate (GHB) and succialate semialdehyde (SSA).
  • GBL ⁇ -butyrolactone
  • GLB ⁇ -hydroxybutyrate
  • SSA succialate semialdehyde
  • This assimilation route is as follows: (i) the lactonase coded by attM converts ⁇ -butyrolactone (GBL) into ⁇ -hydroxybutyrate (GHB), (ii) NAD-alcohol dehydrogenase coded by atlL oxidizes GHB to semialdehyde succinate (SSA) and (iii) NAD-SSA dehydrogenase encoded by attK oxidizes SSA to succinic acid (SA), a compound of the Krebs cycle.
  • GBL, GHB and SSA are inducers of the expression of the attKLM operon capable of specifically inactivating endogenous and exogenous NAHL signals in Agrobaclerium tumefaciens and in a complex microflora (bacterial consortium); these inducers are capable of stimulating the expression of a lactonase (endogenous) in these bacteria and, consequently, the enzymatic degradation of endogenous and exogenous NAHLs by said bacteria.
  • the inducers of the ⁇ -butyrolactone degradation pathway represent new antibacterial compounds.
  • NAHL ⁇ -butyrolactone
  • the degradation pathway for ⁇ -butyrolactone represents a metabolic target for the identification of new antibacterial compounds, capable of specifically inactivating the NAHL signal in pathogenic bacteria using this signal.
  • This new approach to interrupt the signa] NAHL which is based on stimulating the natural capacities of a prokaryotic or eukaryotic organism, in particular a bacteria or a human or non-human mammal to be degraded.
  • der NAHL is called “metabolic quenching”; it consists in stimulating the expression of endogenous lactonase (s) in said organism, by the induction of a metabolic pathway, using biodegradable chemical compounds.
  • the subject of the present invention is the use of an inducer of the ⁇ -butyrolactone degradation pathway to increase the enzymatic degradation of N-acyl homoserine lactone in Gram negative pathogenic bacteria sensitive to the N- signal.
  • acyl homoserine lactone excluding butyric acid and -hydroxy- ⁇ -methylbutyric acid.
  • the term “inducer of the degradation pathway of ⁇ -butyrolactone” means a compound capable of activating the metabolic pathway as defined above, in a prokaryotic or eukaryotic organism, in particular a bacterium or a human or non-human mammal.
  • the induction of the ⁇ -butyrolactone degradation pathway in said organism is measured, either directly by measuring the lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate ) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the degradation pathway of ⁇ -butyrolactone as defined above (lactonase, NAD alcohol dehydrogenase, NAD-SSA dehydrogenase), either indirectly by comparative measurement of the amount of NAHL degraded in the presence or absence of an inducer.
  • the term "sensitive to the N-acyl homoserine lactone signal (NAHL) signal” means Gram-negative pathogenic bacteria capable of perceiving the NAHL signal, that is to say of detecting the presence of NAHL. in their environment and respond to this signal by activating virulence genes, via specific transcription factors, as specified above.
  • these bacteria may also be capable of producing NAHL (NAHL producing bacteria) and therefore of transmitting an NAHL signal; thus bacteria sensitive to the NAHL signal include Gram-negative pathogenic bacteria capable of perceiving or perceiving and emitting an NAHL signal.
  • the invention encompasses the use of natural or synthetic chemical compounds, produced by chemical synthesis or by a microbiological process, in particular using a modified microorganism, in particular by the introduction of an appropriate recombinant vector, which compounds have the properties as defined above.
  • said inducer is chosen from the compounds corresponding to formula (1):
  • said inducer is chosen from: ⁇ -butyrolactone, ⁇ -hydroxybutyrate, semialdehyde succinate and ⁇ -aminobutyric acid ,.
  • said derived salts are in particular sodium, potassium, phosphate, carbonate salts; preferably it is a physiologically or pharmaceutically acceptable salt.
  • said inducer is used for the preparation of a medicament for the prevention and treatment of infections by pathogenic Gram-negative bacteria sensitive to the N-acyl homoserine lactone signal, in man and animals.
  • the medicament as defined above is capable of stimulating the expression of endogenous lactonase (s) in an individual
  • the compounds of formula (1) and their salts are used enterally (oral, sublingual), parenteral or local. They can be in the form of tablets, simple or coated, capsules, granules, syrup, suppositories, injections, ointments, creams, gels, aerosol, which are prepared according to the usual methods .
  • the compounds of formula (I) are associated with excipients usually used in pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, butter of cocoa, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • excipients usually used in pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, butter of cocoa, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • the useful dosage varies depending on the condition to be treated, the route and the rhythm of administration, as well as the nature and weight of the species to be treated (human or animal).
  • Burkholderia mallei Aeromonas aerophila
  • Chromobacterium violaceum Chromobacterium violaceum
  • Yersininia enterocolitica Yersinia pseudotuberculosis
  • Serratia liquefaciens Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in animals, there may be mentioned, without limitation: mammalian and bird pathogens such as Se ⁇ -atia liquefaciens and pathogens of fish and crustaceans such as Aeromonas aerophila, Aeromonas salmonicida, Vibrio anguillarum, and Vibrio han'eyi, Yersinia ruckeri.
  • said medicament comprises semialdehyde succinate or ⁇ aminobutyric acid.
  • said inducer is intended for phytosanitary use, for the prevention and / or treatment of infections by pathogenic microorganisms producing N-acyl homoserine lactone, in plants.
  • said inductor is intended for agrifood use, for the preservation of fresh products, in particular fruits and vegetables.
  • said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria (pathogenic or non-pathogenic) present in the environment, ie cultures, especially in the soil, i.e. crops during storage.
  • lactonases are capable of degrading the N-acyl homoserine lactones produced and / or detected by bacteria which are pathogenic for plant crops or which can damage crops.
  • said inductor is used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or tubs or crops during storage.
  • said inducer when used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or tubs, it is used in the form of a mixed composition comprising nutrients for plant crops as defined above, especially for potato or rice crops in a greenhouse or in a container.
  • N-acyl homoserine lactone which are responsible for infections in plants
  • Envinia sp in particular, Erwinia carotovora and Erwinia chrysantemi
  • Burkholderia sp. In particular Burkholderia cepacia, Burkholderia glumae, Burkholderia plantarii, Agrobaclerium tumefaciens, Pantoea stewartii and Ralstonia solanacearum.
  • said inductor is used to disinfect the environment or the equipment.
  • Said antibacterial product is used, without limitation, to disinfect: soil, water, or equipment for medical or surgical, industrial or domestic use.
  • said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria associated with surfaces in the form of biofilms, and therefore of inducing the degradation of N-acyl homoserine lactones produced by pathogenic bacteria using this signal.
  • the present invention also relates to an inducer of the degradation pathway for ⁇ -butyrolactone as defined above as a medicament.
  • the formulation and the dosage of the said drug are as defined above.
  • the present invention also relates to a method of selection / screening of antibacterial compounds, characterized in that it comprises at least the following steps: a) bringing an organism or cells derived from said organism into contact with a compound to test, b) measuring by any appropriate means the induction of the degradation pathway for ⁇ -butyrolactone in said organism or said cells, and c) selecting the compounds capable of inducing the degradation pathway of the ⁇ -butyrolactone in said organism or said cells.
  • said organism is a prokaryotic organism such as a bacterium or eukaryote such as a non-human mammal and said cells are primary cells or cell lines.
  • said compound When it is a non-human mammal, said compound is administered by oral, local or parenteral route.
  • the induction of the ⁇ -butyrolactone degradation pathway in said organism or said cells is measured, either directly by measuring the lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the degradation pathway of ⁇ -butyrolactone as defined above.
  • the present invention also relates to eukaryotic or prokaryotic cells modified by the genes of the synthetic pathway of an inducer as defined above.
  • the present invention also relates to a transgenic non-human mammal, characterized in that all or part of its cells are modified by the genes of the synthetic pathway of an inducer as defined above.
  • the present invention also relates to a transgenic plant, characterized in that all or part of its cells are modified by the genes of the synthetic pathway of an inducer as defined above.
  • transgenic organisms make it possible to promote the fight against Gram-negative pathogenic bacteria sensitive to the NAHL signal.
  • the polynucleotides according to the invention are obtained by conventional methods, known in themselves, by following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. A USUBEL, 2000, Wiley and son Inc, Libra y of Congress, USA). For example, they can be obtained by amplification of a nucleic sequence by PCR or RT-PCR, by screening of genomic DNA libraries by hybridization with a homologous probe, or else by total or partial chemical synthesis.
  • Recombinant vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods, which are known per se.
  • the transgenic animals and plants according to the invention are obtained by the conventional methods of transgenesis, according to standard protocols as described in Transgenic Mouse: Methods and Protocols; Methods in Molecular Biology, Clifton, NJ, Volume. 209, October 2002. Edited by: Marten H. Hofl ⁇ r, Jan Van Deursen, Martern H. Hofker and Jan Van Deursen. Posted by Holly T. Sklar: Humana Press.
  • the compounds as defined in the present invention in particular semialdehyde succinate have the following advantages over the NAHL signal inactivators of the art previous: they are inexpensive and biodegradable; the use of these compounds requires neither the construction of transgenic plants, nor the inoculation of genetically modified bacteria, nor the use of antibiotics.
  • the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples demonstrating the capacity of the inducers of the ⁇ -butyrolactone degradation pathway to inactivate the NAHL signal.
  • FIG. 1 is a schematic representation of the attJKLM region of A tumefaciens, as well as of the various bacterial and plasmid constructs derived from this region, used in this study.
  • the double lines represent the DNA of the cloning vector, the single lines and the open boxes represent the DNA of the plasmid pAt of the strain C58 to'A. tumefaciens.
  • - Figure 2 illustrates the structure of the compounds used in this study.
  • - Figure 3 illustrates the expression à'attL and ⁇ tt in E. coli.
  • - Figure 4 illustrates the growth of A.
  • A. Growth curves in AB-GBL medium, of: A. tumefaciens C58 (solid squares), A. tumefaciens Cl 01 (empty squares), and A. tumefaciens C58 containing the plasmids p6000 (solid triangles) or pMIRl 13 ( empty triangles).
  • FIG. 6 illustrates the accumulation of NAHL in the absence of attKLM inducers.
  • the A. tumefaciens strains are cultivated in AB- medium mannitol.
  • A the concentration of oxo-C8HSL in the culture medium is compared at two stages (GP1 and GP2) during the growth of A. tumefaciens C58 (full squares) and Cl 01 (empty squares).
  • B the expression of the attK :: lacZ fusion is measured in A. tumefaciens C58, in the presence of increasing concentrations of C6HSL (empty squares) and oxo-C8HSL (solid squares).
  • K lacZ is measured during the exponential (empty bars) and stationary (gray bars) growth phases.
  • the ⁇ -galactosidase activity measurements are carried out in four independent cultures and expressed in Miller units.
  • Figure 7 illustrates the inactivation of the signa] NAHL in the presence of attKLM inducers.
  • a-KG ⁇ -ketoglutaric acid
  • 2-AB acid 2- aminobutyric or ⁇ -aminobutyric
  • 3-AB 3-aminobutyric acid or ⁇ -aminobutyriq ⁇ e
  • GABA 4-aminobutyric or ⁇ -aminobutyric acid
  • SSA semialdehyde succinic acid
  • 2-HB 2-hydroxybutyric or ⁇ -hydroxybutyric acid
  • 3-HB 3-hydroxybutyric or ⁇ -hydroxybutyric acid
  • GHB ⁇ -hydroxybutyric acid or 4-hydroxybutyric acid
  • GBL ⁇ -butyrolactone.
  • tumefaciens induced by GABA were cultured for 20 h in AB-mannitol medium (black square) or AB-mannitol supplemented with 2 mM of GBL (white square), GHB (white triangle) or GABA (white diamond). The cultures were then washed with NaCl (0.8%) and their ability to degrade C6HSL (25 ⁇ M) was tested as described in Example 4.
  • - Figure 1] illustrates the inactivation of the NAHL signal by presence of GABA.
  • the concentration of oxo-C8HSL present in cultures of A tumefaciens C58 was measured after 20 h of culture in medium AB-mannitol (AB) and AB-mannitol supplemented with 2 mM of GHB (AB + GHB), GBL (AB + LNG) or GABA (AB + GABA).
  • AB AB-mannitol
  • AB + GHB GHB + GHB
  • GBL AB + LNG
  • GABA AB + GABA
  • Bacterial strains The examples use the C58 strain of A tumefaciens as well as its derivatives C58.C1, C58.C2 and C58.00, deficient for the plasmids respectively, pTi (C58.C1), pAt (C58.C2) , and pTi and pAt (C58.00), (Naudequin- Dransart V. et ai, Mol. Plant-Microbe Internet., 1998, 11, 583-591).
  • the mutant AattJKLM aph of A tumefaciens, named Cl 01
  • Figure 1 derived from the C58 strain by a standard method of gene replacement by the introduction of a suicide plasmid, by electroporation (Ugalde JE. et al., J. BacterioL, 1998, 180, 6557-6564). More specifically, the aph gene isolated from the plasmid p34S-m (Dennis J. and Zylstra JC, Appl. Env. Microbiol., 1998, 64, 2710-2715), was used to replace the attJKLM region (gi : 17938588) between nucleotides 143 303 and 146, with reference to the sequence of the plasmid pAtC58 (Wood DW.
  • the NTLR4 strains of A tumefaciens (Cha C. et al, Mol. Plant-Microbe Interact., 1998, 1 1, 1 1 19-1 129) and CV026 of Chromobacterium violaceum (McClean KH. Et al, Microbiol., 1997 , 143, 3703-371 1) are used as an AHSL sensor, respectively for oxo-C8HSL and C6HSL. 2) Culture conditions The DH5 ⁇ strain of E. coli is the routine host for the cloning and gene expression experiments. The DH5 ⁇ strain is cultivated at 37 ° C.
  • mannitol is also used as a carbon source for all precultures & Agrobaclerium. Growth growth curves A tumefaciens and E. coli are established s by measuring the optical density (OD) at 600 nm.
  • antibiotics are used at the following concentrations: ampicillin (50mg / l), kanamycin (50mg / l) and tetracycline (10mg / 1). 3) Plasmids
  • the diagrams of the plasmids used are presented in FIG. 1.
  • the plasmid pMIR102 which constitutively expresses the lactonase coded by the attM gene is described in Carlier A. et al, Appl. Approx. Microbiol., 2003, 69, 4989-4993.
  • the plasmid was constructed by cloning into the pGEM ® -T vector (Promega, Madison, USA), an amplification of attL gene fragment obtained using primers (5'-3 '), SEQ 1D N ° 1: ATACCTGTGCTCGGCCATC and SEQ ID N ° 2: TGCTGTCAGAAATGGGTCAG.
  • the plasmid pMIR113 was constructed by cloning between the BamHI and Pstldvi sites, plasmid pME6000 (Maurhofer M.
  • the plasmid pMIR123 constitutively expressing the lacZ gene was obtained by cloning the lacZ-aph cassette in front of the Pk promoter of the vector p6010 (Heeb S. et al, Mol. Plant-Microbe Interact., 2000, 13, 232-237).
  • Example 2 The attM and attL genes code for proteins involved in the assimilation of ⁇ -butyrolactone. Analysis of the amino acid sequences of the attK and attL gene products shows a strong identity between AttK and several NAD-succinate semi-aldehyde dehydrogenase (71% with NAD-dependent dehydrogenase from COG1012) and between AttL and several NAD-alcohol dehydrogenases (49% with alcohol dehydrogenase IV from COG1454); the COG family has been defined by Tatusov et al., NAR, 2001, 29, 22-28. This analysis indicates that the three enzymes encoded by this operon could participate in the GBL degradation pathway.
  • FIG. 3 shows that the expression of attL is sufficient to convert E. coli into a bacterium which effectively assimilates GHB, but that attL and attM are simultaneously necessary for the growth of E. coli in the presence of GBL.
  • Example 3 The growth of A. tumefaciens in the presence of GBL is dependent on the attKLM operon; GBL, GHB and SSA stimulate transcription of attKLM.
  • GBL has been verified experimentally by analysis of the growth of the C58 strain and of the mutants derived therefrom, in minimum medium (AB) supplemented with GBL, GHB, SSA or
  • GHB and SSA stimulate the transcription of attKLM
  • the effect of GBL, GHB and SSA on the transcription of the operon attKLM was analyzed by measuring the ⁇ -galactosidase activity in A tumefaciens C58 transformed by electroporation, either by the plasmid pMIR122 carrying the transcriptional fusion attK :: lacZ, or by the plasmid pMIR121 carrying the transcriptional fusion attJr.
  • ⁇ -galactosidase activity is measured using o-nitrophenyl ⁇ D galactopyranoside as substrate and expressed in Miller units (Sambrook J. et al, Molecular cloning: a laboratory manual 1989, 2 nd Ed. Vol 3). Four independent cultures are produced for each experimental condition. In the induction experiments, the cells containing the transcriptional fusions are cultured in AB-mannitol medium, then 360 ⁇ l of these cells are mixed with 40 ⁇ l of inducer solution to be tested and incubated for 2 hours at 24 ° C. until 'that the measurement of ⁇ -galactosidase activity is carried out.
  • Example 4 Interference between the expression of attKLM and the AHSL signals 1) Quantification of the NAHL
  • the oxo-C8HSL produced by A tumefaciens are extracted with ethyl acetate from a sample of 8 ml of supernatant of culture of Agrobacterium, and concentrated 100 times before quantification.
  • the NAHL disappearance tests are carried out in E. coli after addition to the medium of C6HSL at 25 ⁇ M as described by Carlier et al. Appl. Approx. Microbiol., 2003, 69, 4989-4993, and in A tumefaciens after addition of C6HSL at 25 ⁇ M and oxo-C8HSL at 10 ⁇ M.
  • the cultures of A tumefaciens in stationary phase are centrifuged and the pellet is resuspended at a cell density of 5.10 CFU / ml in fresh AB medium supplemented with mannitol, GBL, GHB, SSA or SA as a source of carbon.
  • the induced cells are washed with 0.8% NaCl and inoculated at 10 9 CFU / ml in fresh AB medium, supplemented with mannitol (0.2 g / l) and NH 4 C1 ( 0.1 g / 1) and with either C6HSL (25 ⁇ M) or oxo-C8HSL (10 ⁇ M).
  • the amount of residual NAHL in the culture medium is tested by thin layer reverse liquid chromatography (TLC; KC18 plates, Whatman ® ); the samples are separated in a methanokeau solvent system (60:40), in comparison with a range of appropriate reference products, of known concentration, as described in Cha C. et al, Mol. Plant-Microbe Interact., 1998, 11, 1 1 19-1129 and McClean KH. et al, Microbiol., 1997, 143, 3703-371 1.
  • a tumefaciens grows in AB-GBL medium, it does not accumulate oxo-C8HSL in the culture medium and becomes capable of inactivating the endogenous and exogenous C6HSL and oxo-C8HSL signals since the expression AttM lactonase is induced ( Figures 7A and 7B).
  • the broad spectrum of NAHL which may be cleaved by lactonase indicates that under conditions in which the attKLM operon is induced, A tumefaciens is capable of interrupting any NAHL signal; it therefore becomes a bacterium effectively degrading NAHL.
  • Example 5 The inducers ⁇ attKLM stimulate the capacity of a complex flora to inactivate NAHL Samples of the teluric microflora are enriched as follows: the bacterial suspensions obtained from temperate soil (Gif- sur- Yvette, France ) are inoculated at the rate of 10 3 CFU / ml (final density) in an AB medium supplemented with yeast extracts (0.2 g / l), actidione (100 mg / l) and GBL, GHB, SSA, SA or mannitol as a carbon source.
  • Example 6 Identification of a new inducer of the GBL degradation pathway in A. tumefaciens, GABA or ⁇ -aminobutyric acid.
  • GABA was tested as described in Example 4.
  • the induction of the attKLM operon by GABA is correlated with the stimulation of the degradation of C6-HSL by A tumefaciens C58, in the presence of GABA (FIG. 10) .
  • Induction by GABA limits the accumulation of NAHLs naturally synthesized by A tumefaciens C58.
  • a tumefaciens C58 naturally produces a NAHL, 3-oxo-C8-HSL.
  • the induction of the attKLM operon by GABA is correlated with the drop in the concentration of 3-oxo-C8-HSL in the culture medium of A tumefaciens C58 ( Figure 11).
  • GABA is an inducer of the attKLM operon which codes for the assimilation of GBL by A tumefaciens C58 and the inactivation of the NAHL signal thanks to the lactonase AttM.
  • a tumefaciens C58 is unable to accumulate 3-oxo-C8-HSL in its culture medium, and becomes capable of degrading exogenous NAHLs such as C6- HSL.
  • GABA is therefore a potentially interesting molecule for inactivating the quorums ensing signal via the GBL degradation pathway.

Abstract

The invention relates to the use a gamma -butyrolactone degradation pathway inductor for increasing the enzymatic degradation of a N-acyl homoserine lactone of Gram-negative pathogenic bacteria sensitive to a N-acyl homoserine lactone apart from butyric and alpha -hydroxy- beta -methylbutyric acids and to the application thereof, in particular for agriculture, the agri-food industry and human and animal medicine.

Description

UTILISATION D'INDUCTEURS DE LA VOIE DE DEGRADATION DE LA γ-BUTYROLACTONE POUR INACTIVER LE SIGNAL N-ACYL HOMOSERINE LACTONE La présente invention est relative à l'utilisation d'inducteurs de la voie de dégradation de la γ-butyrolactone pour inactiver le signa] N-acyl homosérine lactone produit par des bactéries pathogènes et aux applications de ces inducteurs comme antibactériens, notamment dans les domaines de l'agriculture, de l'industrie agroalimentaire et de la médecine humaine et animale. L'augmentation constante du nombre de souches de bactéries multi- résistantes aux antibiotiques, ainsi que la formation de biofilms résistants aux antibiotiques, antiseptiques et désinfectants, pose des problèmes dans les domaines de la santé humaine et animale, de l'agriculture et de l'industrie agroalimentaire. En conséquence, pour lutter plus efficacement contre les bactéries pathogènes, il existe un réel besoin de disposer d'alternatives au traitement par les antibiotiques et au nettoyage par les désinfectants classiques. Pour contourner les défenses de l'hôte (humain, anima] ou végétal), les bactéries ont développé une stratégie de contrôle de la virulence par un mécanisme de communication intercellulaire, dépendant de la densité de population, dénommé quorums nsing. Ces bactéries sont capables de produire, de détecter et de répondre à des petites molécules signa], auto-inductibles et diffusibles, dénommées « quormones » ; lorsque la population bactérienne atteint une densité suffisante, la concentration en quormone dépasse un seuil critique et l'expression des gènes de virulence est activée par l'interaction des quormones avec des facteurs régulateurs de la transcription spécifiques, permettant ainsi une attaque synchrone, massive et efficace de l'hôte. Ainsi, l'interruption du signal des quormones, également dénommé quorum quenching représente une nouvelle approche pour identifier de nouveaux composés pouvant être utilisés comme antibactériens aussi bien dans le domaine de la médecine humaine et vétérinaire (prévention et traitement des infections bactériennes), que dans celui de l'agriculture (lutte contre les pathogènes végétaux), de l'industrie agroalimentaire (conservation des aliments) et de la santé humaine et vétérinaire (désinfection de matériel à usage médical, industrie], domestique, ainsi que de l'environnement), (pour une revue voir Camara et al., The Lancet, 2002, 2, 667-676 et Zhang et al., Trends in Plant Science, 2003, 8, 238-244). Différentes quormones, chacune produite (signal endogène) et/ou détectée (signal exogène) par des bactéries de type différent, ont été identifiées ; butyrolactones chez les bactéries à Gram positif du genre Streptomyces, L-homosérine lactone non-acétylée chez E. coli et N-acyl homosérine lactones (NAHL) chez de nombreuses bactéries pathogènes à Gram négatif. Il a été montré que des bactéries (non-productrices de quormone) pouvaient détecter un signal exogène ; par exemple la L-homosérine lactone a un effet bactériostatique sur certaines souches de mycobactéries à croissance lente (Demande Internationale WO 97/27851). Les N-acyl homosérine lactones sont parmi les quormones les mieux connues chez les bactéries à Gram négatif, notamment celles appartenant aux genres Burkholderia, Eι-winia et Pseudomonas, responsables de la destruction des cultures de plantes d'intérêt agronomique comme le riz ou la pomme de terre, ainsi que d'infections nosocomiales et opportunistes chez l'homme. Les NAHL sont constituées d'un cycle homosérine lactone, lié par l'intermédiaire d'une liaison amide à un groupement acyle d'une chaîne carbonée en C4-C) , saturée ou insaturée, éventuellement substituée au niveau du carbone en position 3, par un groupement hydroxyle ou carbonyle (Figure 1 de Camara et al., précité). Elles interagissent spécifiquement avec des facteurs de transcription de la famille LuxR, permettant ainsi de maintenir la concentration intracellulaire en facteur LuxR qui sont instables et rapidement dégradés en l'absence de liaison avec des NAHL. La biosynthèse des NAHL implique la synthèse d'acyl-ACP (ACP pour Acyl Carrier Protein) par la voie de synthèse des acides gras et la catalyse de la réaction entre PAcyl-ACP et la S-adénosylméthionine, par la NAHL synthase. La dégradation enzymatique des NAHL implique deux voies distinctes, la première impliquant une hydrolase à zinc dénommée lactonase, et la seconde une acylase. Parmi les gènes codant respectivement pour ces lactonases et ces acylases, on peut citer : le gène aiiA chez Bacillus sp (Dong et al., P.N.A.S., 2000, 97, 3526-3531) et ses homologues comme les gènes atlM chez Agrobacterium tumefaciens (Zhang et al., P.N.A.S., 2002, 99, 4638-4643) et ahlD chez Arthobacter sp. (Park et al., Microbiol, 2003, 149, 1541-1550), et le gène aiiD chez Ralstonia sp. (Lin et al., Mol. Microbiol., 2003, 47, 849-860) et ses homologues comme le gène pvdQ chez Pseudomonas aeruginosa (Huang et al., Appl. Env. Microbiol., 2003, 69, 5941 -5949). Différentes stratégies ont été envisagées pour interrompre le signa] NAHL : - inhibition de la synthèse des NAHL ; le triclosan est un antibiotique qui inhibe la synthèse des acides gras, eux mêmes nécessaires à la synthèse des NAHL (Hoang et al., J. BacterioL, 1999, 191 , 5489-5497). Toutefois cet antibiotique n'est pas spécifique des NAHL et entraîne des résistances. - inhibition de la reconnaissance du signal NAHL par les récepteurs cellulaires bactériens ; l'utilisation d'analogues des NAHL incluant notamment des furanones halogénées et des dérivés d'amides ou de 1 ,2-acylhydrazine (Manefield et al, Appl. Environ. Microbiol., 2000, 66, 2079-2084 ; Demandes Internationales WO 03/039529 et WO 96/29392 ; Brevet américain US 6,455,031) a été proposée. Les furanones halogénées foπnent un complexe instable avec les facteurs de transcription de la famille LuxR et accélèrent la dégradation de ces protéines (Hentzer et al., EMBO, 2003, 22, 3803-3815). Toutefois, ces composés ne sont pas des inhibiteurs spécifiques du signal NAHL et ils sont inutilisables en médecine humaine et vétérinaire du fait de leur toxicité. - dégradation enzymatique des NAHL par expression de lactonases et d'acylases exogènes ; l'utilisation de vecteurs recombinants ou de bactéries exprimant une lactonase exogène, ainsi que de plantes et d'animaux transgéniques dérivés a été proposée (Demandes internationales PCT WO 02/061099 et WO 02/16623 ; Dong et al., Nature, 2001, 411, 813-817 ; Dong et al., PNAS, 2000, 97, 3526-3631 ; Leadbetter et al., J. BacterioL, 2000, 182, 6921-6926 ; Uroz et al., Microbiol., 2003, 149, 1981-1989) ; des plantes transgéniques exprimant la lactonase exogène codée par le gène aiiA de Bacillus sp sont plus résistantes à l'infection par des bactéries pathogènes productrices de NAHL que les plantes non modifiées. Toutefois, cette approche est lourde à mettre en œuvre étant donné qu'elle implique la construction de plantes ou d'animaux transgéniques ou l'inoculation de vecteurs recombinants exprimant une lactonase ou une acyl as e. Les stratégies' envisagées n'ont jusqu'à présent pas permis d'identifier de composés capables d'inactiver le signal NAHL, qui soient spécifiques, non-toxiques et faciles à mettre en œuvre. En conséquence, les Inventeurs se sont donné pour but l'identification de tels composés. La voie de dégradation de la γ-butyrolactone (GBL) implique trois enzymes : (i) la lactonase convertit la γ-butyrolactone (GBL) en γ-hydroxybutyrate (GHB), (ii) la NAD-alcool déshydrogénase oxyde le GHB en succinate semialdéhyde (SSA) et (iii) la NAD-SSA déshydrogénase oxyde le SSA en acide succinique (SA), un composé du cycle de Krebs. Alors que SA et SSA sont des intermédiaires de différentes voies métaboliques, communs aux eucaryotes et aux procaryotes, GHB et GBL sont rares dans la nature. GHB est décrit essentiellement comme un intermédiaire métabolique de GBL possédant des propriétés psychotropes (Mason et al., Acad. Emerg. Med., 2003, 9, 730-739). GBL est produit à des fins industrielles et est trouvé chez les plantes et dans les boissons fermentées comme le vin (Lee et al. J. Agri. Food. Chem., 2000, 48, 4290-4293 ; Vose et al., J. Forensic Sc , 2000, 46, 1 164-1 167) ; il est également décrit comme possédant des propriétés antiparisitaires contre les nématodes du sol (Brevet américain US 3 086 907). En outre, des composés, différents de GHB, GBL, SSA et SA, mais possédant une structure apparentée comme des acides carboxyliques en C3-C8, notamment l'acide butyrique, le butyrate et leurs dérivés substitués par des groupements méthyle, hydroxy et/ou amino, ont été décrits comme possédant des propriétés inhibitrices de la croissance des champignons et des bactéries en général, notamment aussi bien chez les bactéries à Gram positif comme les coques (acide γ- a ino butyrique et γ-amino-β-hydroxybutyrique) que chez les bactéries à Gram négatif comme notamment Pseudomonas aeruginosa, Salmonella cholerasuis et typhimurium, Escherichia coli, Klebsellia pneumoniae (acide butyrique et acide α- hydroxy-β-méthyl-butyrique), (Demandes Internationales WO 97/27851 , WO 97/00676, WO 01/57174 ; Brevets US 3 895 1 16, US 4 550 026, US 3 629 451 , US 4 179 522 ; RU 2 0348 807 ; JP 2001 20681 1). La voie de dégradation de la γ-butyrolactone a été mise en évidence uniquement chez l'homme et le rat mais pas chez les bactéries (Mason et al., précité). Le gène attM de A. tumefaciens appartient à l'opéron allKLM qui, à ce jour, est unique parmi les génomes bactériens séquences ; il code pour une lacto- nase qui ouvre le cycle γ-butyrolactone des NAHL et appartient à la famille des hydrolases à zinc (Zhang et al., précité ; Carlier A. et al, Appl. Env. Microbiol., 2003, 69, 4989-4993). La fonction des autres gènes de l'opéron attKLM n'a pas été identifiée. En outre, l'implication de l'opéron attKLM dans une voie métabolique n'est pas décrite. Les Inventeurs ont montré que l'opéron attKLM est impliqué dans la voie de dégradation et d'assimilation de la γ-butyrolactone (GBL), du γ-hydroxybutyrate (GHB) et du succinate semialdéhyde (SSA). Cette voie d'assimilation est la suivante : (i) la lactonase codée par attM convertit la γ-butyrolactone (GBL) en γ-hydroxybutyrate (GHB), (ii) la NAD-alcool déshydrogé- nase codée par atlL oxyde le GHB en succinate semialdéhyde (SSA) et (iii) la NAD- SSA déshydrogénase codée par attK oxyde le SSA en acide succinique (SA), un composé du cycle de Krebs. Ils ont également montré que GBL, GHB et SSA sont des inducteurs de l'expression de l'opéron attKLM capables d'inactiver spécifiquement les signaux NAHL endogènes et exogènes chez Agrobaclerium tumefaciens et dans une microflore complexe (consortium bactérien) ; ces inducteurs sont capables de stimuler l'expression d'une lactonase (endogène) chez ces bactéries et par voie de conséquence la dégradation enzymatique des NAHL endogènes et exogènes par lesdites bactéries. Ainsi, les Inventeurs ont montré que les inducteurs de la voie de dégradation de la γ-butyrolactone représentent de nouveaux composés antibactériens. En outre, du fait de son implication dans la dégradation enzymatique des NAHL, la voie de dégradation de la γ-butyrolactone représente une cible métabolique pour l'identification de nouveaux composés antibactériens, capables d'inactiver spécifiquement le signal NAHL chez les bactéries pathogènes utilisant ce signal. Cette nouvelle approche pour interrompre le signa] NAHL, qui repose sur la stimulation des capacités naturelles d'un organisme procaryote ou euca- ryote, notamment d'une bactérie ou d'un mammifère humain ou non-humain à dégra- der les NAHL est dénommée « metabolic quenching » ; elle consiste à stimuler l'expression de lactonase(s) endogène(s) chez ledit organisme, par l'induction d'une voie métabolique, à l'aide de composés chimiques biodégradables. En conséquence, la présente invention a pour objet l'utilisation d'un inducteur de la voie de dégradation de la γ-butyrolactone pour augmenter la dégradation enzymatique de la N-acyl homosérine lactone chez les bactéries pathogènes à Gram négatif sensibles au signal N-acyl homosérine lactone, à l'exclusion de l'acide butyrique et de l'acide -hydroxy-β-méthylbutyrique. Au sens de la présente invention, on entend par un inducteur de la voie de dégradation de la γ- butyrolactone, un composé capable d'activer la voie métabolique telle que définie ci- dessus, chez un organisme procaryote ou eucaryote, notamment une bactérie ou un mammifère humain ou non-humain. L'induction de la voie de dégradation de la γ-butyrolactone chez ledit organisme est mesurée, soit directement par mesure des activités lactonase (GBL comme substrat), NAD alcool déshydrogénase (GHB comme substrat), et NAD-SSA déhydrogénase (SSA comme substrat) ou par mesure de l'activité d'un gène rapporteur placé sous le contrôle d'un promoteur d'un gène codant pour une enzyme de la voie de dégradation de la γ-butyrolactone telle que définie ci-dessus (lactonase, NAD alcool déshydrogénase, NAD-SSA déhydrogénase), soit indirectement par mesure comparative de la quantité de NAHL dégradée en présence ou en l'absence d'inducteur. Les méthodes de mesure de l'activité d'un gène rapporteur et de la quantité de NAHL dégradée sont des méthodes classiques connues de l'Homme du métier. Au sens de la présente invention, on entend par « sensibles au signal N-acyl homosérine lactone (NAHL)», des bactéries pathogènes à Gram négatif capables de percevoir le signal NAHL, c'est-à-dire de détecter la présence de NAHL dans leur environnement et de répondre à ce signal en activant des gènes de virulence, par l'intermédiaire de facteurs de transcription spécifiques, comme précisé ci-dessus. En outre, ces bactéries peuvent également être capables de produire du NAHL (bactéries productrices de NAHL) et donc d'émettre un signal NAHL ; ainsi les bactéries sensibles au signal NAHL englobent des bactéries pathogènes à Gram négatif capables de percevoir ou de percevoir et d'émettre un signal NAHL. L'invention englobe l'utilisation de composés chimiques naturels ou synthétiques, produits par synthèse chimique ou par un procédé microbiologique, notamment à l'aide d'un microorganisme modifié, notamment par l'introduction d'un vecteur recombinant approprié, lesquels composés présentent les propriétés telles que définies ci-dessus. Selon un mode de réalisation avantageux de l'utilisation selon l'invention, ledit inducteur est choisi parmi les composés répondant à la formule (1) :The present invention relates to the use of inducers of the γ-butyrolactone degradation pathway to inactivate the signal.] The present invention relates to the use of inducers of the γ-butyrolactone degradation pathway. N-acyl homoserine lactone produced by pathogenic bacteria and applications of these inducers as antibacterials, especially in the fields of agriculture, the food industry and human and animal medicine. The constant increase in the number of strains of bacteria multi- resistant to antibiotics, as well as the formation of biofilms resistant to antibiotics, antiseptics and disinfectants, poses problems in the fields of human and animal health, agriculture and agriculture. 'food industry. Consequently, to fight more effectively against pathogenic bacteria, there is a real need to have alternatives to treatment with antibiotics and cleaning with conventional disinfectants. To circumvent the defenses of the host (human, animal or plant), bacteria have developed a virulence control strategy by a mechanism of intercellular communication, dependent on the density of population, called quorums nsing. These bacteria are capable of producing, detecting and responding to small, self-inducing and diffusible molecules signa], called "quormones"; when the bacterial population reaches a sufficient density, the concentration of quormone exceeds a critical threshold and the expression of virulence genes is activated by the interaction of quormones with specific factors regulating transcription, thus allowing a synchronous, massive and efficient host. Thus, the interruption of the signal of the quormones, also called quorum quenching represents a new approach to identify new compounds which can be used as antibacterials both in the field of human and veterinary medicine (prevention and treatment of bacterial infections), as in that of agriculture (fight against plant pathogens), the agrifood industry (food preservation) and human and veterinary health (disinfection of equipment for medical use, industry], domestic, as well as the environment), (for a review see Camara et al., The Lancet, 2002, 2, 667-676 and Zhang et al., Trends in Plant Science, 2003, 8, 238-244). Different quormones, each produced (endogenous signal) and / or detected (exogenous signal) by bacteria of different types, have been identified; butyrolactones in Gram-positive bacteria of the genus Streptomyces, non-acetylated L-homoserine lactone in E. coli and N-acyl homoserine lactones (NAHL) in many Gram-negative pathogenic bacteria. It has been shown that bacteria (which do not produce quormone) can detect an exogenous signal; for example L-homoserine lactone has a bacteriostatic effect on certain strains of slow-growing mycobacteria (International Application WO 97/27851). N-acyl homoserine lactones are among the best known quormones in Gram-negative bacteria, in particular those belonging to the genera Burkholderia, Eι-winia and Pseudomonas, responsible for the destruction of crops of plants of agronomic interest such as rice or potato, as well as nosocomial and opportunistic infections in humans. The NAHLs consist of a lactone homoserine ring, linked via an amide bond to an acyl group of a C 4 -C carbon chain, saturated or unsaturated, optionally substituted at the carbon level in position 3 , by a hydroxyl or carbonyl group (Figure 1 of Camara et al., cited above). They interact specifically with transcription factors of the LuxR family, thus making it possible to maintain the intracellular concentration of LuxR factor which are unstable and rapidly degraded in the absence of binding with NAHLs. NAHL biosynthesis involves the synthesis of acyl-ACP (ACP for Acyl Carrier Protein) by the fatty acid synthesis pathway and the catalysis of the reaction between PAcyl-ACP and S-adenosylmethionine, by NAHL synthase. The enzymatic degradation of NAHL involves two distinct pathways, the first involving a zinc hydrolase called lactonase, and the second an acylase. Among the genes coding respectively for these lactonases and these acylases, there may be mentioned: the aiiA gene in Bacillus sp (Dong et al., PNAS, 2000, 97, 3526-3531) and its counterparts such as the atlM genes in Agrobacterium tumefaciens (Zhang et al., PNAS, 2002, 99, 4638-4643) and ahlD in Arthobacter sp. (Park et al., Microbiol, 2003, 149, 1541-1550), and the aiiD gene in Ralstonia sp. (Lin et al., Mol. Microbiol., 2003, 47, 849-860) and its counterparts such as the pvdQ gene in Pseudomonas aeruginosa (Huang et al., Appl. Env. Microbiol., 2003, 69, 5941 -5949) . Different strategies have been considered to interrupt the NAHL signal: - inhibition of NAHL synthesis; triclosan is an antibiotic which inhibits the synthesis of fatty acids, themselves necessary for the synthesis of NAHL (Hoang et al., J. BacterioL, 1999, 191, 5489-5497). However, this antibiotic is not specific to NAHL and causes resistance. - inhibition of recognition of the NAHL signal by bacterial cell receptors; the use of analogs of NAHL including in particular halogenated furanones and derivatives of amides or 1, 2-acylhydrazine (Manefield et al, Appl. Environ. Microbiol., 2000, 66, 2079-2084; International Applications WO 03 / 039529 and WO 96/29392; US patent US 6,455,031) has been proposed. Halogenated furanones form an unstable complex with the transcription factors of the LuxR family and accelerate the degradation of these proteins (Hentzer et al., EMBO, 2003, 22, 3803-3815). However, these compounds are not specific inhibitors of the NAHL signal and they cannot be used in human and veterinary medicine because of their toxicity. - enzymatic degradation of NAHL by expression of exogenous lactonases and acylases; the use of recombinant vectors or bacteria expressing an exogenous lactonase, as well as derived transgenic plants and animals has been proposed (PCT international applications WO 02/061099 and WO 02/16623; Dong et al., Nature, 2001, 411, 813-817; Dong et al., PNAS, 2000, 97, 3526-3631; Leadbetter et al., J. BacterioL, 2000, 182, 6921-6926; Uroz et al., Microbiol., 2003, 149, 1981-1989); transgenic plants expressing exogenous lactonase encoded by the aiiA gene from Bacillus sp are more resistant to infection by pathogenic bacteria producing NAHL than unmodified plants. However, this approach is cumbersome to implement since it involves the construction of transgenic plants or animals or the inoculation of recombinant vectors expressing a lactonase or an acyl as e. Strategies' envisaged have so far failed to identify compounds capable of inactivating the HSL signal, which are specific, non-toxic and easy to implement. Consequently, the inventors have set themselves the goal of identifying such compounds. The degradation pathway for γ-butyrolactone (GBL) involves three enzymes: (i) lactonase converts γ-butyrolactone (GBL) to γ-hydroxybutyrate (GHB), (ii) NAD-alcohol dehydrogenase oxidizes GHB to succinate semialdehyde (SSA) and (iii) NAD-SSA dehydrogenase oxidizes SSA to succinic acid (SA), a compound in the Krebs cycle. While SA and SSA are intermediaries of different metabolic pathways, common to eukaryotes and prokaryotes, GHB and GBL are rare in nature. GHB is mainly described as a metabolic intermediate of GBL with psychotropic properties (Mason et al., Acad. Emerg. Med., 2003, 9, 730-739). GBL is produced for industrial purposes and is found in plants and in fermented drinks such as wine (Lee et al. J. Agri. Food. Chem., 2000, 48, 4290-4293; Vose et al., J. Forensic Sc, 2000, 46, 1 164-1 167); it is also described as having antiparasitic properties against soil nematodes (American patent US 3,086,907). In addition, compounds, different from GHB, GBL, SSA and SA, but having a related structure like C 3 -C 8 carboxylic acids, in particular butyric acid, butyrate and their derivatives substituted by methyl or hydroxy groups and / or amino, have been described as having inhibitory properties on the growth of fungi and bacteria in general, especially in Gram positive bacteria such as cockles (γ- a ino butyric acid and γ-amino-β- hydroxybutyric) than in Gram negative bacteria such as Pseudomonas aeruginosa, Salmonella cholerasuis and typhimurium, Escherichia coli, Klebsellia pneumoniae (butyric acid and α-hydroxy-β-methyl-butyric acid), (International applications WO 97/27851, WO 97 / 00676, WO 01/57174; US Patents 3,895 1,16, US 4,550,026, US 3,629,451, US 4,179,522; RU 2,0348,807; JP 2001 20,681 1). The degradation pathway for γ-butyrolactone has been demonstrated only in humans and rats but not in bacteria (Mason et al., Cited above). The attM gene of A. tumefaciens belongs to the allKLM operon which, to date, is unique among the sequenced bacterial genomes; it codes for a lactonase which opens the γ-butyrolactone cycle of NAHL and belongs to the family of zinc hydrolases (Zhang et al., cited above; Carlier A. et al, Appl. Env. Microbiol., 2003, 69, 4989-4993). The function of the other genes of the attKLM operon has not been identified. In addition, the involvement of the attKLM operon in a metabolic pathway is not described. The inventors have shown that the attKLM operon is involved in the degradation and assimilation pathway for γ-butyrolactone (GBL), γ-hydroxybutyrate (GHB) and succialate semialdehyde (SSA). This assimilation route is as follows: (i) the lactonase coded by attM converts γ-butyrolactone (GBL) into γ-hydroxybutyrate (GHB), (ii) NAD-alcohol dehydrogenase coded by atlL oxidizes GHB to semialdehyde succinate (SSA) and (iii) NAD-SSA dehydrogenase encoded by attK oxidizes SSA to succinic acid (SA), a compound of the Krebs cycle. They also showed that GBL, GHB and SSA are inducers of the expression of the attKLM operon capable of specifically inactivating endogenous and exogenous NAHL signals in Agrobaclerium tumefaciens and in a complex microflora (bacterial consortium); these inducers are capable of stimulating the expression of a lactonase (endogenous) in these bacteria and, consequently, the enzymatic degradation of endogenous and exogenous NAHLs by said bacteria. Thus, the inventors have shown that the inducers of the γ-butyrolactone degradation pathway represent new antibacterial compounds. In addition, due to its involvement in the enzymatic degradation of NAHL, the degradation pathway for γ-butyrolactone represents a metabolic target for the identification of new antibacterial compounds, capable of specifically inactivating the NAHL signal in pathogenic bacteria using this signal. This new approach to interrupt the signa] NAHL, which is based on stimulating the natural capacities of a prokaryotic or eukaryotic organism, in particular a bacteria or a human or non-human mammal to be degraded. der NAHL is called “metabolic quenching”; it consists in stimulating the expression of endogenous lactonase (s) in said organism, by the induction of a metabolic pathway, using biodegradable chemical compounds. Consequently, the subject of the present invention is the use of an inducer of the γ-butyrolactone degradation pathway to increase the enzymatic degradation of N-acyl homoserine lactone in Gram negative pathogenic bacteria sensitive to the N- signal. acyl homoserine lactone, excluding butyric acid and -hydroxy-β-methylbutyric acid. For the purposes of the present invention, the term “inducer of the degradation pathway of γ-butyrolactone” means a compound capable of activating the metabolic pathway as defined above, in a prokaryotic or eukaryotic organism, in particular a bacterium or a human or non-human mammal. The induction of the γ-butyrolactone degradation pathway in said organism is measured, either directly by measuring the lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate ) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the degradation pathway of γ-butyrolactone as defined above (lactonase, NAD alcohol dehydrogenase, NAD-SSA dehydrogenase), either indirectly by comparative measurement of the amount of NAHL degraded in the presence or absence of an inducer. The methods for measuring the activity of a reporter gene and the amount of degraded NAHL are conventional methods known to those skilled in the art. For the purposes of the present invention, the term "sensitive to the N-acyl homoserine lactone signal (NAHL) signal" means Gram-negative pathogenic bacteria capable of perceiving the NAHL signal, that is to say of detecting the presence of NAHL. in their environment and respond to this signal by activating virulence genes, via specific transcription factors, as specified above. In addition, these bacteria may also be capable of producing NAHL (NAHL producing bacteria) and therefore of transmitting an NAHL signal; thus bacteria sensitive to the NAHL signal include Gram-negative pathogenic bacteria capable of perceiving or perceiving and emitting an NAHL signal. The invention encompasses the use of natural or synthetic chemical compounds, produced by chemical synthesis or by a microbiological process, in particular using a modified microorganism, in particular by the introduction of an appropriate recombinant vector, which compounds have the properties as defined above. According to an advantageous embodiment of the use according to the invention, said inducer is chosen from the compounds corresponding to formula (1):
M R2 M R2
Figure imgf000008_0001
Figure imgf000008_0001
dans laquelle Ri, R2 et R3 représentent chacun un hydrogène, un groupement hydroxyle, aminé ou =O, ou bien un groupement alkyle, acyle ou hydroxyalkyle en Cj-C ; étant entendu que lorsque R3 est un groupement hydroxyle, il peut réagir avec le groupement hydroxyle porté par le carbone en position 1 (Ci) pour former un ester cyclique (lactone), ainsi que leurs sels dérivés. Selon une disposition avantageuse de ce mode de réalisation, R3 représente, un groupement hydroxyle, aminé ou =O, ou bien un groupement acyle ou hydroxyalkyle en C]-C4) et R2 est différent d'une aminé primaire. De préférence, ledit inducteur est choisi parmi : la γ-butyrolactone, le γ-hydroxybutyrate, le succinate semialdéhyde et l'acide γ-aminobutyrique,. Conformément à l'invention, lesdits sels dérivés sont notamment des sels de sodium, de potassium, de phosphate, de carbonate ; de préférence il s'agit d'un sel physiologiquement ou pharmaceutiquement acceptable. Selon un mode de réalisation avantageux de l'invention, ledit inducteur est utilisé pour la préparation d'un médicament pour la prévention et le traitement d'infections par des bactéries pathogènes à Gram négatif sensibles au signal N-acyl homosérine lactone , chez l'homme et les animaux. Conformément à l'invention, le médicament tel que défini ci-dessus est capable de stimuler l'expression de lactonase(s) endogène(s) chez un individuin which R 1, R 2 and R 3 each represent a hydrogen, a hydroxyl, amine or = O group, or else a C 1 -C 4 alkyl, acyl or hydroxyalkyl group; it being understood that when R 3 is a hydroxyl group, it can react with the hydroxyl group carried by the carbon in position 1 (Ci) to form a cyclic ester (lactone), as well as their derived salts. According to an advantageous arrangement of this embodiment, R 3 represents a hydroxyl, amine or = O group, or else an acyl or hydroxyalkyl group (C 1 -C 4) and R 2 is different from a primary amine. Preferably, said inducer is chosen from: γ-butyrolactone, γ-hydroxybutyrate, semialdehyde succinate and γ-aminobutyric acid ,. According to the invention, said derived salts are in particular sodium, potassium, phosphate, carbonate salts; preferably it is a physiologically or pharmaceutically acceptable salt. According to an advantageous embodiment of the invention, said inducer is used for the preparation of a medicament for the prevention and treatment of infections by pathogenic Gram-negative bacteria sensitive to the N-acyl homoserine lactone signal, in man and animals. According to the invention, the medicament as defined above is capable of stimulating the expression of endogenous lactonase (s) in an individual
(homme ou animal) ou bien chez les bactéries de la flore dudit individu, et donc d'induire la dégradation enzymatique des N-acyl homosérine lactones produites et/ou détectées par des bactéries qui sont pathogènes pour cet individu. Selon ce mode de réalisation avantageux, les composés de formule (1) et leurs sels sont utilisés par voie entérale (orale, sublinguale), parentérale ou locale. Ils peuvent se présenter sous la forme de comprimés, simples ou dragéifiés, de gélules, de granules, de sirop, de suppositoires, de préparations injectables, de pommades, de crèmes, de gels, d'aérosol, lesquels sont préparés selon les méthodes usuelles. Dans ces formes galéniques, les composés de formule (I) sont associés à des excipients habituellement employés dans des compositions pharmaceutiques, tels que le talc, la gomme arabique, le lactose, l'amidon, le stéarate de magné- sium, le beurre de cacao, les véhicules aqueux ou non, les corps gras d'origine animale ou végétale, les dérivés paraffiniques, les glycols, les divers agents mouillants, dispersants ou émulsifiants, les conservateurs. La posologie utile varie en fonction de l'affection à traiter, de la voie et du rythme d'administration, ainsi que de la nature et du poids de l'espèce à traiter (humaine ou animale). Parmi les microorganismes pathogènes producteurs de N-acyl homosérine lactone, qui sont responsables d'infections chez l'homme, on peut citer, de façon non-limitative : Pseudomonas aeruginosa, Burkholderia cepacia,(human or animal) or in bacteria of the flora of said individual, and therefore induce the enzymatic degradation of N-acyl homoserine lactones produced and / or detected by bacteria which are pathogenic for this individual. According to this advantageous embodiment, the compounds of formula (1) and their salts are used enterally (oral, sublingual), parenteral or local. They can be in the form of tablets, simple or coated, capsules, granules, syrup, suppositories, injections, ointments, creams, gels, aerosol, which are prepared according to the usual methods . In these dosage forms, the compounds of formula (I) are associated with excipients usually used in pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, butter of cocoa, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives. The useful dosage varies depending on the condition to be treated, the route and the rhythm of administration, as well as the nature and weight of the species to be treated (human or animal). Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in humans, there may be mentioned, without limitation: Pseudomonas aeruginosa, Burkholderia cepacia,
Burkholderia mallei, Aeromonas aerophila, Chromobacterium violaceum, Yersininia enterocolitica, Yersinia pseudotuberculosis et Serratia liquefaciens. Parmi les microorganismes pathogènes producteurs de N-acyl homosérine lactone, qui sont responsables d'infections chez les animaux, on peut citer, de façon non-limitative : des pathogènes de mammifères et d'oiseaux tels que Seπ-atia liquefaciens et des pathogènes de poisson et de crustacés tels qu'Aeromonas aerophila, Aeromonas salmonicida, Vibrio anguillarum, et Vibrio han'eyi, Yersinia ruckeri. Selon une disposition avantageuse de ce mode de réalisation, ledit médicament comprend du succinate semialdéhyde ou de l'acide γaminobutyrique. Selon un autre mode de réalisation avantageux de l'invention, ledit inducteur est destiné à un usage phytosanitaire, pour la prévention et/ou le traitement d'infections par des microorganismes pathogènes producteurs de N-acyl homosérine lactone, chez les plantes. Selon encore un autre mode de réalisation avantageux de l'invention, ledit inducteur est destiné à un usage agroalimentaire, pour la conservation des produits frais, notamment des fruits et de légumes. Conformément à l'invention, ledit inducteur tel que défini ci-dessus est capable de stimuler l'expression de lactonase(s) endogène(s) chez les bactéries (pathogènes ou non-pathogènes) présentes dans l'environnement, soit des cultures, notamment dans le sol, soit des récoltes lors du stockage. Ces lactonases sont capables de dégrader les N-acyl homosérine lactones produites et/ou détectées par des bactéries pathogènes pour les cultures végétales ou pouvant endommager les récoltes. Ainsi, ledit inducteur est utilisé pour la protection des cultures végétales au champ, ou en milieu confiné, telles que les serres ou les bacs ou bien des récoltes lors du stockage. Avantageusement, lorsque ledit inducteur est utilisé pour la protection des cultures végétales au champ, ou en milieu confiné, telles que les serres ou les bacs, il est utilisé sous forme d'une composition mixte comprenant des éléments nutritifs pour les cultures végétales telles que définies ci-dessus, notamment pour les cultures de pomme de terre ou de riz en serre ou en bac. Parmi les microorganismes pathogènes producteurs de N-acyl homosérine lactone, qui sont responsables d'infections chez les plantes on peut citer de façon non-limitative : Envinia sp, notamment, Erwinia carotovora et Erwinia chrysantemi, Burkholderia sp., notamment Burkholderia cepacia, Burkholderia glumae, Burkholderia plantarii, Agrobaclerium tumefaciens, Pantoea stewartii et Ralstonia solanacearum. Selon un autre mode de réalisation avantageux de l'invention, ledit inducteur est utilisé pour désinfecter l 'environnement ou le matériel. Ledit produit antibactérien est utilisé, de façon non-limitative, pour désinfecter : le sol, l'eau, ou bien du matériel à usage médical ou chirurgical, industriel ou domestique. Conformément à l'invention, ledit inducteur tel que défini ci-dessus est capable de stimuler l'expression de lactonase(s) endogène(s) chez les bactéries associées à des surfaces sous forme de biofilms, et donc d'induire la dégradation des N-acyl homosérine lactones produites par des bactéries pathogènes utilisant ce signal. La présente invention a également pour objet un inducteur de la voie de dégradation de la γ-butyrolactone tel que défini ci-dessus comme médicament. La formulation et la posologie dudit médicament sont telles que définies ci-dessus. La présente invention a également pour objet un procédé de sélection/criblage de composés antibactériens, caractérisé en ce qu'il comprend au moins les étapes suivantes : a) la mise en contact d'un organisme ou de cellules dérivées dudit organisme avec un composé à tester, b) la mesure par tout moyen approprié de l'induction de la voie de dégradation de la γ-butyrolactone chez ledit organisme ou lesdites cellules, et c) la sélection des composés capables d'induire la voie de dégrada- tion de la γ-butyrolactone chez ledit organisme ou lesdites cellules. Conformément à l'invention : - ledit organisme est un organisme procaryote tel qu'une bactérie ou eucaryote tel qu'un mammifère non-humain et lesdites cellules sont des cellules primaires ou des lignées cellulaires. - lorsqu'il s'agit d'un mammifère non-humain, ledit composé est administré par voie orale, locale ou parentérale. - l'induction de la voie de dégradation de la γ-butyrolactone chez ledit organisme ou lesdites cellules est mesurée, soit directement par mesure des activités lactonase (GBL comme substrat), NAD alcool déshydrogénase (GHB comme substrat), et NAD-SSA déhydrogénase (SSA comme substrat) ou par mesure de l'activité d'un gène rapporteur placé sous le contrôle d'un promoteur d'un gène codant pour une enzyme de la voie de dégradation de la γ-butyrolactone telle que définie ci- dessus (lactonase, NAD alcool déshydrogénase, NAD-SSA déhydrogénase), soit indirectement par mesure comparative de la quantité de NAHL dégradée en présence ou en l'absence d'inducteur. Les méthodes de mesure de l'activité d'un gène rapporteur et de la quantité de NAHL dégradée sont les méthodes classiques connues de l'Homme du métier. La présente invention a également pour objet des cellules eucaryotes ou procaryotes modifiées par les gènes de la voie de synthèse d'un inducteur tel que défini ci-dessus. La présente invention a également pour objet un mammifère non- humain transgénique, caractérisé en ce que tout ou partie de ses cellules sont modifiées par les gènes de la voie de synthèse d'un inducteur tel que défini ci-dessus. La présente invention a également pour objet une plante transgénique, caractérisé en ce que tout ou partie de ses cellules sont modifiées par les gènes de la voie de synthèse d'un inducteur tel que défini ci-dessus. De tels organismes transgéniques permettent de favoriser la lutte contre les bactéries pathogène à Gram négatif sensibles au signal NAHL. Les polynucléotides selon l'invention sont obtenus par les méthodes classiques, connues en elles-mêmes, en suivant les protocoles standards tels que ceux décrits dans Current Protocols in Molecular Biology (Frederick M. A USUBEL, 2000, Wiley and son Inc, Libra y of Congress, USA). Par exemple, ils peuvent être obtenus par amplification d'une séquence nucléique par PCR ou RT-PCR, par criblage de banques d'ADN génomique par hybridation avec une sonde homologue, ou bien par synthèse chimique totale ou partielle. Les vecteurs recombinants sont construits et introduits dans des cellules hôtes par les méthodes classiques d'ADN recombinant et de génie génétique, qui sont connues en elles-mêmes. Les animaux et plantes transgéniques selon l'invention sont obtenus par les procédés classiques de transgénèse, selon les protocoles standards tels que décrits dans Transgenic Mouse: Methods and Protocols ; Methods in Molecular Biology, Clifton, N.J., Volume. 209, Octobre 2002. Edité par : Marten H. Hoflœr, Jan Van Deursen, Martern H. Hofker et Jan Van Deursen. Publié par Holly T. Sklar : Humana Press. Les composés tels que définis dans la présente invention, notamment le succinate semialdéhyde présentent les avantages suivants par rapport aux inactivateurs du signal NAHL de l'art antérieur : ils sont peu coûteux et biodégradables ; l'utilisation de ces composés ne nécessite ni la construction de plantes transgéniques, ni l'inoculation de bactéries génétiquement modifiées, ni l'utilisation d'antibiotiques. Outre les dispositions qui précèdent, l'invention comprend encore d'autres dispositions qui ressortiront de la description qui va suivre, qui se réfère à des exemples démontrant la capacité des inducteurs de la voie de dégradation de la γ- butyrolactone à inactiver le signal NAHL endogène et exogène chez les bactéries, ainsi qu'aux dessins annexés dans lesquels : - la figure 1 est une représentation schématique de la région attJKLM de A tumefaciens, ainsi que des différentes constructions bactériennes et plasmidiques dérivées de cette région, utilisées dans cette étude. Les lignes doubles représentent l'ADN du vecteur de clonage, les lignes simples et les boites ouvertes représentent l'ADN du plasmide pAt de la souche C58 à'A. tumefaciens. - la figure 2 illustre la structure des composés utilisés dans cette étude. - la figure 3 illustre l'expression à'attL et d'αtt chez E. coli. - la figure 4 illustre la croissance de A. tumefaciens en présence de GBL, GHB, SA et SSA. A. : Courbes de croissance en milieu AB-GBL, de : A. tumefaciens C58 (carrés pleins), A. tumefaciens Cl 01 (carrés vides), et A. tumefaciens C58 contenant les plasmides p6000 (triangles pleins) ou pMIRl 13 (triangles vides). B : Courbes de croissance de A. tumefaciens C58 (carrés pleins) et A. tumefaciens Cl 01 (carrés vides) en milieu AB-GHB, AB-SSA et AB-SA. Les expériences sont réalisées en triplicat, les déviations standard étant inférieures à la taille des symboles utilisés. - la figure 5 illustre l'expression des fusions transcriptionnelles attJr. lacZ et attK::lacZ chez A. tumefaciens C58. L'activité β-galactosidase des bactéries mesurée à partir de quatre cultures indépendantes, est exprimée en unités de Miller. Avant les mesures d'activité β-galactosidase, les cellules sont incubées avec des concentrations croissantes des facteurs suivants : (A) mannitol (carrés vides), GBL (carrés noirs) ; (B) mannitol (carrés vides), GHB (carrés noirs), SSA (carrés gris). - la figure 6 illustre l'accumulation de NAHL en l'absence d'inducteurs de attKLM. Les souches de A. tumefaciens sont cultivées en milieu AB- mannitol. A : la concentration en oxo-C8HSL dans le milieu de culture est comparée à deux temps (GP1 et GP2) durant la croissance de A. tumefaciens C58 (carrés pleins) et Cl 01 (carrés vides). B : l'expression de la fusion attK::lacZ est mesurée chez A. tumefaciens C58, en présence de concentrations croissantes de C6HSL (carrés vides) et de oxo-C8HSL (carrés pleins). C : l'expression des fusions transcriptionnelles attJr.lacZ , attKr.lacZ et de la fusion constitutive ?k::lacZ est mesurée durant les phases de croissance exponentielle (barres vides) et stationnaire (barres grises). Les mesures d'activité β-galactosidase sont réalisées dans quatre cultures indépendantes et exprimées en unités de Miller. - la figure 7 illustre l'inactivation du signa] NAHL en présence des inducteurs de attKLM. Les quantités résiduelles de C6HSL (A, C, D et F) et oxo- C8HSL (graphiques B et E) présentes dans les cultures inoculées avec tumefaciens sont mesurées et exprimées en pourcentage par rapport aux quantités correspondantes de C6HSL et C8HSL présentes dans un milieu contrôle non inoculé (quantité de C6HSL et C8HSL = 100). Avant leur inoculation dans un milieu contenant des NAHL, les cellules de tumefaciens C58 (symboles vides) et Cl 01 (symboles pleins) sont induites par l'un des facteurs suivants : (A, B, D et E) mannitol (carré), GBL (triangle) ; (C et F), SA (carré), SSA (triangle) et GHB (losange). Les expériences sont réalisées en triplicat. . - la figure 8 illustre l'inactivation du signal NAHL par une microflore complexe activée. Après enrichissement en milieu GBL (carré vide), GHB (triangle vide), SSA (losange vide), SA (carré plein), la capacité de la microflore télurique (A : 109 UFC/ml et B : 108 UFC/ml) a dégrader le C6HSL (25 μM) est testée. La quantité résiduelle de C6HSL est exprimée en pourcentage, par rapport à la quantité de C6HSL présente dans une microflore contrôle activée par du mannitol (quantité de C6HSL = 100). Les résultats correspondent à quatre mesures effectuées dans quatre expériences indépendantes. - la figure 9 illustre l'identification d'inducteurs de l'expression de l'opéron attKLM chez A. tumefaciens C58. Les mesures de l'activité β-galactosidase (exprimée en unités de Miller), sont réalisées sur des cultures de A. tumefaciens C58 (pMIR122), cultivées en milieu AB mannitol et incubées pendant 2 h en présence des différents composés testés (ImM). a-KG : acide α-cétoglutarique ; 2-AB : acide 2- aminobutyrique ou α-aminobutyrique ; 3-AB : acide 3-aminobutyrique ou β- aminobutyriqυe ; GABA : acide 4-aminobutyrique ou γ-aminobutyrique ; SSA : acide succinique semialdéhyde ; 2-HB : acide 2-hydroxybutyrique ou α-hydroxybutyrique ; 3-HB : acide 3-hydroxybutyrique ou β-hydroxybutyrique ; GHB : acide γ- hydroxybutyrique ou acide 4-hydroxybutyrique ; GBL : γ-butyrolactone. - la figure 10 illustre la dégradation de C6HSL chez A. tumefaciens induit par le GABA. A. tumefaciens a été cultivé pendant 20 h en milieu AB-mannitol (carré noir) ou AB-mannitol supplémenté avec 2 mM de GBL (carré blanc), GHB (triangle blanc) ou GABA (losange blanc). Les cultures ont ensuite été lavées avec du NaCl (0,8 %) et leur aptitude à dégrader la C6HSL (25 μM) a été testée comme décrit à l'exemple 4. - la figure 1 ] illustre l'inactivation du signal NAHL en présence de GABA. La concentration d'oxo-C8HSL présente dans des cultures d'A tumefaciens C58 a été mesurée après 20 h de culture dans du milieu AB-mannitol (AB) et AB- mannitol supplémenté avec 2 mM de GHB (AB+GHB), GBL (AB+GNL) ou GABA (AB+ GABA). Exemple 1 : Souches et plasmides utilisés pour l'étude de l'opéron attKLM Dans les exemples, les souches bactériennes et les plasmides suivants ont été utilisés dans les conditions telles que décrites ci-après. 1) Souches bactériennes Les exemples mettent en œuvre la souche C58 de A tumefaciens ainsi que ses dérivés C58.C1, C58.C2 et C58.00, déficientes pour les plasmides respectivement, pTi (C58.C1), pAt (C58.C2), et pTi et pAt (C58.00), (Naudequin- Dransart V. et ai, Mol. Plant-Microbe Internet., 1998, 11, 583-591). Le mutant AattJKLM::aph de A tumefaciens, dénommé Cl 01Burkholderia mallei, Aeromonas aerophila, Chromobacterium violaceum, Yersininia enterocolitica, Yersinia pseudotuberculosis and Serratia liquefaciens. Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in animals, there may be mentioned, without limitation: mammalian and bird pathogens such as Seπ-atia liquefaciens and pathogens of fish and crustaceans such as Aeromonas aerophila, Aeromonas salmonicida, Vibrio anguillarum, and Vibrio han'eyi, Yersinia ruckeri. According to an advantageous arrangement of this embodiment, said medicament comprises semialdehyde succinate or γaminobutyric acid. According to another advantageous embodiment of the invention, said inducer is intended for phytosanitary use, for the prevention and / or treatment of infections by pathogenic microorganisms producing N-acyl homoserine lactone, in plants. According to yet another advantageous embodiment of the invention, said inductor is intended for agrifood use, for the preservation of fresh products, in particular fruits and vegetables. In accordance with the invention, said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria (pathogenic or non-pathogenic) present in the environment, ie cultures, especially in the soil, i.e. crops during storage. These lactonases are capable of degrading the N-acyl homoserine lactones produced and / or detected by bacteria which are pathogenic for plant crops or which can damage crops. Thus, said inductor is used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or tubs or crops during storage. Advantageously, when said inducer is used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or tubs, it is used in the form of a mixed composition comprising nutrients for plant crops as defined above, especially for potato or rice crops in a greenhouse or in a container. Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in plants, there may be mentioned, without limitation: Envinia sp, in particular, Erwinia carotovora and Erwinia chrysantemi, Burkholderia sp., In particular Burkholderia cepacia, Burkholderia glumae, Burkholderia plantarii, Agrobaclerium tumefaciens, Pantoea stewartii and Ralstonia solanacearum. According to another advantageous embodiment of the invention, said inductor is used to disinfect the environment or the equipment. Said antibacterial product is used, without limitation, to disinfect: soil, water, or equipment for medical or surgical, industrial or domestic use. According to the invention, said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria associated with surfaces in the form of biofilms, and therefore of inducing the degradation of N-acyl homoserine lactones produced by pathogenic bacteria using this signal. The present invention also relates to an inducer of the degradation pathway for γ-butyrolactone as defined above as a medicament. The formulation and the dosage of the said drug are as defined above. The present invention also relates to a method of selection / screening of antibacterial compounds, characterized in that it comprises at least the following steps: a) bringing an organism or cells derived from said organism into contact with a compound to test, b) measuring by any appropriate means the induction of the degradation pathway for γ-butyrolactone in said organism or said cells, and c) selecting the compounds capable of inducing the degradation pathway of the γ-butyrolactone in said organism or said cells. According to the invention: - said organism is a prokaryotic organism such as a bacterium or eukaryote such as a non-human mammal and said cells are primary cells or cell lines. - When it is a non-human mammal, said compound is administered by oral, local or parenteral route. the induction of the γ-butyrolactone degradation pathway in said organism or said cells is measured, either directly by measuring the lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the degradation pathway of γ-butyrolactone as defined above. above (lactonase, NAD alcohol dehydrogenase, NAD-SSA dehydrogenase), either indirectly by comparative measurement of the amount of degraded NAHL in the presence or absence of an inducer. The methods for measuring the activity of a reporter gene and the amount of degraded NAHL are the conventional methods known to those skilled in the art. The present invention also relates to eukaryotic or prokaryotic cells modified by the genes of the synthetic pathway of an inducer as defined above. The present invention also relates to a transgenic non-human mammal, characterized in that all or part of its cells are modified by the genes of the synthetic pathway of an inducer as defined above. The present invention also relates to a transgenic plant, characterized in that all or part of its cells are modified by the genes of the synthetic pathway of an inducer as defined above. Such transgenic organisms make it possible to promote the fight against Gram-negative pathogenic bacteria sensitive to the NAHL signal. The polynucleotides according to the invention are obtained by conventional methods, known in themselves, by following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. A USUBEL, 2000, Wiley and son Inc, Libra y of Congress, USA). For example, they can be obtained by amplification of a nucleic sequence by PCR or RT-PCR, by screening of genomic DNA libraries by hybridization with a homologous probe, or else by total or partial chemical synthesis. Recombinant vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods, which are known per se. The transgenic animals and plants according to the invention are obtained by the conventional methods of transgenesis, according to standard protocols as described in Transgenic Mouse: Methods and Protocols; Methods in Molecular Biology, Clifton, NJ, Volume. 209, October 2002. Edited by: Marten H. Hoflœr, Jan Van Deursen, Martern H. Hofker and Jan Van Deursen. Posted by Holly T. Sklar: Humana Press. The compounds as defined in the present invention, in particular semialdehyde succinate have the following advantages over the NAHL signal inactivators of the art previous: they are inexpensive and biodegradable; the use of these compounds requires neither the construction of transgenic plants, nor the inoculation of genetically modified bacteria, nor the use of antibiotics. In addition to the above arrangements, the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples demonstrating the capacity of the inducers of the γ-butyrolactone degradation pathway to inactivate the NAHL signal. endogenous and exogenous in bacteria, as well as in the appended drawings in which: - Figure 1 is a schematic representation of the attJKLM region of A tumefaciens, as well as of the various bacterial and plasmid constructs derived from this region, used in this study. The double lines represent the DNA of the cloning vector, the single lines and the open boxes represent the DNA of the plasmid pAt of the strain C58 to'A. tumefaciens. - Figure 2 illustrates the structure of the compounds used in this study. - Figure 3 illustrates the expression à'attL and αtt in E. coli. - Figure 4 illustrates the growth of A. tumefaciens in the presence of GBL, GHB, SA and SSA. A.: Growth curves in AB-GBL medium, of: A. tumefaciens C58 (solid squares), A. tumefaciens Cl 01 (empty squares), and A. tumefaciens C58 containing the plasmids p6000 (solid triangles) or pMIRl 13 ( empty triangles). B: Growth curves of A. tumefaciens C58 (full squares) and A. tumefaciens Cl 01 (empty squares) in medium AB-GHB, AB-SSA and AB-SA. The experiments are carried out in triplicate, the standard deviations being smaller than the size of the symbols used. - Figure 5 illustrates the expression of attJr transcriptional mergers. lacZ and attK :: lacZ in A. tumefaciens C58. The β-galactosidase activity of bacteria, measured from four independent cultures, is expressed in Miller units. Before the β-galactosidase activity measurements, the cells are incubated with increasing concentrations of the following factors: (A) mannitol (empty squares), GBL (black squares); (B) mannitol (empty squares), GHB (black squares), SSA (gray squares). - Figure 6 illustrates the accumulation of NAHL in the absence of attKLM inducers. The A. tumefaciens strains are cultivated in AB- medium mannitol. A: the concentration of oxo-C8HSL in the culture medium is compared at two stages (GP1 and GP2) during the growth of A. tumefaciens C58 (full squares) and Cl 01 (empty squares). B: the expression of the attK :: lacZ fusion is measured in A. tumefaciens C58, in the presence of increasing concentrations of C6HSL (empty squares) and oxo-C8HSL (solid squares). C: the expression of the attJr.lacZ, attKr.lacZ transcriptional fusions and of the constitutive fusion? K :: lacZ is measured during the exponential (empty bars) and stationary (gray bars) growth phases. The β-galactosidase activity measurements are carried out in four independent cultures and expressed in Miller units. - Figure 7 illustrates the inactivation of the signa] NAHL in the presence of attKLM inducers. The residual quantities of C6HSL (A, C, D and F) and oxo-C8HSL (graphics B and E) present in the cultures inoculated with tumefaciens are measured and expressed as a percentage relative to the corresponding quantities of C6HSL and C8HSL present in a medium. uninoculated control (quantity of C6HSL and C8HSL = 100). Before their inoculation in a medium containing NAHL, the cells of tumefaciens C58 (empty symbols) and Cl 01 (solid symbols) are induced by one of the following factors: (A, B, D and E) mannitol (square), GBL (triangle); (C and F), SA (square), SSA (triangle) and GHB (diamond). The experiments are carried out in triplicate. . - Figure 8 illustrates the inactivation of the NAHL signal by an activated complex microflora. After enrichment in GBL (empty square), GHB (empty triangle), SSA (empty diamond), SA (full square) medium, the capacity of the teluric microflora (A: 10 9 CFU / ml and B: 10 8 CFU / ml ) to degrade C6HSL (25 μM) is tested. The residual amount of C6HSL is expressed as a percentage, relative to the amount of C6HSL present in a control microflora activated by mannitol (amount of C6HSL = 100). The results correspond to four measurements carried out in four independent experiments. - Figure 9 illustrates the identification of inducers of the expression of the attKLM operon in A. tumefaciens C58. The measurements of β-galactosidase activity (expressed in Miller units) are carried out on cultures of A. tumefaciens C58 (pMIR122), cultivated in AB mannitol medium and incubated for 2 h in the presence of the various compounds tested (ImM) . a-KG: α-ketoglutaric acid; 2-AB: acid 2- aminobutyric or α-aminobutyric; 3-AB: 3-aminobutyric acid or β-aminobutyriqυe; GABA: 4-aminobutyric or γ-aminobutyric acid; SSA: semialdehyde succinic acid; 2-HB: 2-hydroxybutyric or α-hydroxybutyric acid; 3-HB: 3-hydroxybutyric or β-hydroxybutyric acid; GHB: γ-hydroxybutyric acid or 4-hydroxybutyric acid; GBL: γ-butyrolactone. - Figure 10 illustrates the degradation of C6HSL in A. tumefaciens induced by GABA. A. tumefaciens was cultured for 20 h in AB-mannitol medium (black square) or AB-mannitol supplemented with 2 mM of GBL (white square), GHB (white triangle) or GABA (white diamond). The cultures were then washed with NaCl (0.8%) and their ability to degrade C6HSL (25 μM) was tested as described in Example 4. - Figure 1] illustrates the inactivation of the NAHL signal by presence of GABA. The concentration of oxo-C8HSL present in cultures of A tumefaciens C58 was measured after 20 h of culture in medium AB-mannitol (AB) and AB-mannitol supplemented with 2 mM of GHB (AB + GHB), GBL (AB + LNG) or GABA (AB + GABA). Example 1: Strains and plasmids used for the study of the attKLM operon In the examples, the following bacterial strains and plasmids were used under the conditions as described below. 1) Bacterial strains The examples use the C58 strain of A tumefaciens as well as its derivatives C58.C1, C58.C2 and C58.00, deficient for the plasmids respectively, pTi (C58.C1), pAt (C58.C2) , and pTi and pAt (C58.00), (Naudequin- Dransart V. et ai, Mol. Plant-Microbe Internet., 1998, 11, 583-591). The mutant AattJKLM :: aph of A tumefaciens, named Cl 01
(figure 1) dérive de la souche C58 par une procédé standard de remplacement de gène par l'introduction d'un plasmide suicide, par électroporation (Ugalde JE. et al., J. BacterioL, 1998, 180, 6557-6564). De manière plus précise, le gène aph isolé à partir du plasmide p34S- m (Dennis J. et Zylstra JC, Appl. Env. Microbiol., 1998, 64, 2710-2715), a été utilisé pour remplacer la région attJKLM (gi :17938588) entre les nucléotides 143 303 et 146 , en référence à la séquence du plasmide pAtC58 (Wood DW. et al, Science, 2001, 294, 2317-2323). Les souches NTLR4 d'A tumefaciens (Cha C. et al, Mol. Plant- Microbe Interact., 1998, 1 1 , 1 1 19-1 129) et CV026 de Chromobacterium violaceum (McClean KH. et al, Microbiol., 1997, 143, 3703-371 1 ) sont utilisées en tant que capteur d'AHSL, respectivement pour oxo-C8HSL et C6HSL. 2) Conditions de culture La souche DH5α d'E. coli est l'hôte de routine pour les expériences de clonage et d'expression de gène. La souche DH5α est cultivée à 37°C dans du milieu riche (milieu LB) et dans du milieu minimum (milieu M9), (Sambroock J. et al, Molecular cloning : a laboratory manual 1989, 2" Ed. Vol. 3), supplémenté avec du NAD (0,66g/l), du γ-aminobutyrate (1 g/1) comme source d'azote (Schneider BL. et al, J. BacterioL, 2002, 184, 6976-6986), et une source de carbone appropriée (2g/l). Les souches de A tumefaciens sont cultivées à 30°C dans du milieu riche (milieu TY) et du milieu minimum (milieu AB), (Chilton MD. et al, Proc. Natl. Acad. Sci. USA, 1974, 71 , 3672-3676), supplémenté avec NH C1 (1 g/1) et une des sources de carbone suivantes (2g/l) : mannitol, γ-butyrolactone (GBL), γ-valerolactone (GVL), homosérine lactone (HSL), γ-hydroxybutyrate (GHB), succinate semialdéhyde (SSA) et acide succinique (SA). Le mannitol est par ailleurs utilisé comme source de carbone pour toutes les précultures & Agrobaclerium. Les courbes de croissance de A tumefaciens et E. coli sont établies par mesure de la densité optique (DO) à 600 nm. Enfin, les antibiotiques sont utilisés aux concentrations suivantes : ampicilline (50mg/l), kanamycine (50mg/l) et tétracycline (lOmg/1). 3) Plasmides Les schémas des plasmides utilisés sont présentés à la figure 1. Le plasmide pMIR102 qui exprime constitutivement la lactonase codée par le gène attM est décrit dans Carlier A. et al, Appl. Env. Microbiol., 2003, 69, 4989-4993. Le plasmide pMIR117 a été construit par clonage dans le vecteur pGEM®-T (Promega, Madison, USA), d'un fragment d'amplification du gène attL, obtenu à l'aide des amorces (5 '-3'), SEQ 1D N° 1 : ATACCTGTGCTCGGCCATC et SEQ ID N° 2 : TGCTGTCAGAAATGGGTCAG. Le plasmide pMIR113 a été construit par clonage entre les sites BamHI et Pstldvi plasmide pME6000 (Maurhofer M. et al, Phytopathol., 1998, 88, 678-684), d'un fragment d'amplification chevauchant le gène attJ, obtenu à l'aide des amorces 5 '-3', SEQ ID N° 3 : CAAACCATCGACGCAATATG et SEQ ID N° 4 : GCGGGATCCCTGGGGTATTGG. Les plasmides pMIR121 et pMIR122 contenant respectivement les fusions transcriptionnelles attJ:lacZ et attKΛacZ, ont été obtenus de la façon suivante : les promoteurs divergents αttJ et attKLM ont été amplifiés en un simple fragment, à l'aide des amorces 5'-3', SEQ ID N° 5 : TCAGCCATGCACTATCCTTGA et SEQ ID N° 6 : GTCTAGCCATCCGCGGCTT, fusionnés avec la cassette lacZ-aph dépourvue de promoteur du plasmide pKOK5 (Kokotek W. et Lotz W., Gène, 1989, 84, 467-471), et les fragment Sphl-SacJ ont été sous-clonés dans le vecteur pME6031 (Heeb S. et al, Mol. Plant-Microbe Interact., 2000, 13, 232-237). Le plasmide pMIR123 exprimant constitutivement le gène lacZ a été obtenu par clonage de la cassette lacZ-aph devant le promoteur Pk du vecteur p6010 (Heeb S. et al, Mol. Plant-Microbe Interact., 2000, 13, 232-237).(Figure 1) derived from the C58 strain by a standard method of gene replacement by the introduction of a suicide plasmid, by electroporation (Ugalde JE. et al., J. BacterioL, 1998, 180, 6557-6564). More specifically, the aph gene isolated from the plasmid p34S-m (Dennis J. and Zylstra JC, Appl. Env. Microbiol., 1998, 64, 2710-2715), was used to replace the attJKLM region (gi : 17938588) between nucleotides 143 303 and 146, with reference to the sequence of the plasmid pAtC58 (Wood DW. Et al, Science, 2001, 294, 2317-2323). The NTLR4 strains of A tumefaciens (Cha C. et al, Mol. Plant-Microbe Interact., 1998, 1 1, 1 1 19-1 129) and CV026 of Chromobacterium violaceum (McClean KH. Et al, Microbiol., 1997 , 143, 3703-371 1) are used as an AHSL sensor, respectively for oxo-C8HSL and C6HSL. 2) Culture conditions The DH5α strain of E. coli is the routine host for the cloning and gene expression experiments. The DH5α strain is cultivated at 37 ° C. in rich medium (LB medium) and in minimum medium (M9 medium), (Sambroock J. et al, Molecular cloning: a laboratory manual 1989, 2 "Ed. Vol. 3) , supplemented with NAD (0.66 g / l), γ-aminobutyrate (1 g / 1) as a nitrogen source (Schneider BL. et al, J. BacterioL, 2002, 184, 6976-6986), and a appropriate carbon source (2 g / l). The strains of A tumefaciens are cultivated at 30 ° C. in rich medium (TY medium) and minimum medium (AB medium), (Chilton MD. et al, Proc. Natl. Acad Sci. USA, 1974, 71, 3672-3676), supplemented with NH C1 (1 g / 1) and one of the following carbon sources (2g / l): mannitol, γ-butyrolactone (GBL), γ-valerolactone ( GVL), homoserine lactone (HSL), γ-hydroxybutyrate (GHB), semialdehyde succinate (SSA) and succinic acid (SA). Mannitol is also used as a carbon source for all precultures & Agrobaclerium. Growth growth curves A tumefaciens and E. coli are established s by measuring the optical density (OD) at 600 nm. Finally, antibiotics are used at the following concentrations: ampicillin (50mg / l), kanamycin (50mg / l) and tetracycline (10mg / 1). 3) Plasmids The diagrams of the plasmids used are presented in FIG. 1. The plasmid pMIR102 which constitutively expresses the lactonase coded by the attM gene is described in Carlier A. et al, Appl. Approx. Microbiol., 2003, 69, 4989-4993. PMIR117 The plasmid was constructed by cloning into the pGEM ® -T vector (Promega, Madison, USA), an amplification of attL gene fragment obtained using primers (5'-3 '), SEQ 1D N ° 1: ATACCTGTGCTCGGCCATC and SEQ ID N ° 2: TGCTGTCAGAAATGGGTCAG. The plasmid pMIR113 was constructed by cloning between the BamHI and Pstldvi sites, plasmid pME6000 (Maurhofer M. et al, Phytopathol., 1998, 88, 678-684), of an amplification fragment overlapping the attJ gene, obtained using the primers 5 '-3', SEQ ID No. 3: CAAACCATCGACGCAATATG and SEQ ID No. 4: GCGGGATCCCTGGGGTATTGG. The plasmids pMIR121 and pMIR122 respectively containing the transcriptional fusions attJ: lacZ and attKΛacZ, were obtained in the following way: the divergent promoters αttJ and attKLM were amplified in a simple fragment, using the primers 5'-3 ', SEQ ID N ° 5: TCAGCCATGCACTATCCTTGA and SEQ ID N ° 6: GTCTAGCCATCCGCGGCTT, fused with the lacZ-aph cassette devoid of the promoter of the plasmid pKOK5 (Kokotek W. and Lotz W., Gene, 1989, 84, 467-471), and the Sphl-SacJ fragments were subcloned into the vector pME6031 (Heeb S. et al, Mol. Plant-Microbe Interact., 2000, 13, 232-237). The plasmid pMIR123 constitutively expressing the lacZ gene was obtained by cloning the lacZ-aph cassette in front of the Pk promoter of the vector p6010 (Heeb S. et al, Mol. Plant-Microbe Interact., 2000, 13, 232-237).
Exemple 2 : Les gènes attM et attL codent pour des protéines impliquées dans l'assimilation de la γ-butyrolactone. L'analyse des séquences en acides aminés des produits des gènes attK et attL montre une forte identité entre AttK et plusieurs NAD-succinate semi- aldéhyde déshydrogénase (71 % avec la NAD-dépendante déshydrogénase de COG1012) et entre AttL et plusieurs NAD-alcool déshydrogénases (49% avec l'alcool déhydrogénase IV de COG1454) ; la famille COG a été définie par Tatusov et al., NAR, 2001, 29, 22-28. Cette analyse indique que les trois enzymes codées par cet opéron pourraient participer à la voie de dégradation de la GBL. L'implication de AttL et AttM dans les deux premières étapes enzymatiques de la voie de dégradation de la GBL, a été vérifiée expérimentalement chez E. coli qui assimile naturellement SA et SSA. La figure 3 montre que l'expression de attL est suffisante pour convertir E. coli en bactérie qui assimile efficacement GHB, mais que attL et attM sont simultanément nécessaires pour la croissance d'E. coli en présence de GBL. Ces résultats indiquent que les trois enzymes codées par cet opéron participent à la voie de dégradation de GBL: (i) la lactonase codée par attM convertie GBL en GHB, (ii) la NAD-alcool déshydrogénase codée par attL oxyde GHB en SAA et (iii) la NAD-SSA déshydrogénase codée par attK oxyde vraisemblablement SSA enExample 2: The attM and attL genes code for proteins involved in the assimilation of γ-butyrolactone. Analysis of the amino acid sequences of the attK and attL gene products shows a strong identity between AttK and several NAD-succinate semi-aldehyde dehydrogenase (71% with NAD-dependent dehydrogenase from COG1012) and between AttL and several NAD-alcohol dehydrogenases (49% with alcohol dehydrogenase IV from COG1454); the COG family has been defined by Tatusov et al., NAR, 2001, 29, 22-28. This analysis indicates that the three enzymes encoded by this operon could participate in the GBL degradation pathway. The involvement of AttL and AttM in the first two enzymatic stages of the GBL degradation pathway has been verified experimentally in E. coli which naturally assimilates SA and SSA. FIG. 3 shows that the expression of attL is sufficient to convert E. coli into a bacterium which effectively assimilates GHB, but that attL and attM are simultaneously necessary for the growth of E. coli in the presence of GBL. These results indicate that the three enzymes coded by this operon participate in the degradation pathway of GBL: (i) the lactonase coded by converted attM GBL into GHB, (ii) NAD-alcohol dehydrogenase encoded by attL oxide GHB into SAA and (iii) NAD-SSA dehydrogenase encoded by attK probably oxidizes SSA into
SA, un composé du cycle de Krebs.SA, a compound of the Krebs cycle.
Exemple 3 : La croissance d'A. tumefaciens en présence de GBL est dépendante de l'opéron attKLM ; GBL, GHB et SSA stimulent la transcription de attKLM.Example 3: The growth of A. tumefaciens in the presence of GBL is dependent on the attKLM operon; GBL, GHB and SSA stimulate transcription of attKLM.
1) La croissance d A tumefaciens en présence de GBL est dépendante de l'opéron attKLM L'i plication de l'opéron attKLM dans la voie d'assimilation de1) The growth of tumefaciens in the presence of GBL is dependent on the attKLM operon The involvement of the attKLM operon in the assimilation pathway
GBL a été vérifiée expérimentalement par l'analyse de la croissance de la souche C58 et des mutants dérivés, en milieu minimum (AB) supplémenté en GBL, GHB, SSA ouGBL has been verified experimentally by analysis of the growth of the C58 strain and of the mutants derived therefrom, in minimum medium (AB) supplemented with GBL, GHB, SSA or
SA comme source de carbone (figure 4).SA as a carbon source (Figure 4).
- croissance en miji eu GBL (figure 4A) La souche C58 d'A tumefaciens, bien qu'elle n'assimile pas un large spectre de lactones, car ni GVL, ni HSL ni C6HSL ne peuvent être utilisés comme source de carbone, est cependant capable de croître en présence de GBL comme source de carbone. En revanche son dérivé Cl 01 (AattJKLM::aph) qui ne possède pas l'opéron attKLM en est incapable. Ce dernier phénotype est aussi observé lorsque des copies additionnelles du gène attJ codant pour des répresseurs transcriptionnels de atlKLM sont introduites dans A tumefaciens C58. L'implication de ces gènes codés par le plasmide pAt dans l'assimilation de la GBL est en accord avec les phénotypes des souches C58.C2,- growth in miji eu GBL (FIG. 4A) The C58 strain of A tumefaciens, although it does not assimilate a broad spectrum of lactones, because neither GVL, neither HSL nor C6HSL can be used as carbon source, is however capable of growing in the presence of GBL as a carbon source. On the other hand its derivative Cl 01 (AattJKLM :: aph) which does not have the attKLM operon is incapable of it. This latter phenotype is also observed when additional copies of the attJ gene coding for transcriptional repressors of atlKLM are introduced into A tumefaciens C58. The implication of these genes encoded by the plasmid pAt in the assimilation of GBL is in agreement with the phenotypes of the strains C58.C2,
C58.00 et C58.C1 ; les souches C58.C2 et C58.00 qui sont dépourvues de pAt ne peuvent pas croître en milieu AB-GBL, alors que la souche C58.C1 dans laquelle on a enlevé le plasmide pTi mais qui garde pAt, croît en milieu AB-GBL.C58.00 and C58.C1; strains C58.C2 and C58.00 which are devoid of pAt cannot grow in AB-GBL medium, while strain C58.C1 in which the plasmid pTi has been removed but which keeps pAt, grows in AB-GBL medium .
- croissance en milieu GHBS.SSA, SA (figure 4B) Le mutant Cl 01 est aussi affecté dans l'assimilation de GHB et SSA, alors qu'aucune différence n'est observée entre C58 et Cl 01 durant leur croissance en milieu AB- SA. 2) GBL. GHB et SSA stimulent la transcription de attKLM L'effet de GBL, GHB et SSA sur la transcription de l'opéron attKLM a été analysée par mesure de l'activité β-galactosidase chez A tumefaciens C58 transformé par électroporation, soit par le plasmide pMIR122 portant la fusion transcriptionnelle attK::lacZ, soit par le plasmide pMIR121 portant la fusion transcriptionnelle attJr. lacZ, utilisé en comparaison. L'activité de la β-galactosidase est mesurée en utilisant l'o-nitro- phenyl β D galactopyranoside comme substrat et exprimée en unités de Miller (Sambrook J. et al, Molecular cloning : a laboratory manual 1989, 2nd Ed. Vol. 3). Quatre cultures indépendantes sont réalisées pour chaque condition expérimentale. Dans les expériences d'induction, les cellules contenant les fusions transcriptionnelles sont cultivées dans du milieu AB-mannitol, puis 360 μl de ces cellules sont mélangés avec 40 μl de solution d'inducteur à tester et incubées pendant 2 heures à 24°C jusqu'à ce que la mesure de l'activité β-galactosidase soit effectuée. L'addition de GBL à la culture de bactéries augmente fortement l'expression de la fusion attKr.lacZ alors qu'une addition équivalente de mannitol n'a pas d'effet (figure 5). L'expression de la fusion attJr. lacZ est légèrement augmentée par l'addition de GBL (figure 5), indiquant que des facteurs cellulaires additionnels ou des modifications post-transcriptionnelles du facteur AttJ, comme des changements conformationnels en présence de GBL, pourraient participer à la régulation de l'opéron attKLM. Les autres lactones, telles que GVL et HSL n'induisent pas l'expression de l'opéron attKLM alors que les deux intermédiaires métaboliques de la voie d'assimilation de GBL, GHB et SSA sont efficaces comme inducteurs (figure 5). Exemple 4 : Interférence entre l'expression de attKLM et les signaux AHSL 1 ) Quantification des NAHL Les oxo-C8HSL produites par A tumefaciens sont extraites avec de l'acétate d'éthyle, à partir d'un échantillon de 8 ml de surnageant de culture de Agrobacterium, et concentrées 100 fois avant quantification. Les essais de disparition des NAHL sont réalisé chez E. coli après addition dans le milieu de C6HSL à 25 μM comme décrit par Carlier et al. Appl. Env. Microbiol., 2003, 69, 4989-4993, et dans A tumefaciens après addition de C6HSL à 25 μM et oxo-C8HSL à 10 μM. Dans cette expérience, les cultures de A tumefaciens en phase stationnaire sont centrifugées et le culot est remis en suspension à une densité cellulaire de 5.10 UFC/ml dans du milieu AB frais supplémenté en mannitol, GBL, GHB, SSA ou SA comme source de carbone. Après 15 heures d'incubation sous agitation, les cellules induites sont lavées avec du NaCl 0,8% et inoculées à 109 UFC/ml dans du milieu AB frais, supplémenté avec du mannitol (0.2g/l) et NH4C1 (0,1 g/1) et avec, soit C6HSL (25 μM), soit oxo- C8HSL (10 μM). La quantité de NAHL résiduelles dans le milieu de culture est testée par chromatographie liquide inverse sur couche mince (TLC ; plaques KC18, Whatman®) ; les échantillons sont séparés dans un système de solvant méthanokeau (60:40), en comparaison avec une gamme de produits de référence appropriés, de concentration connue, telle que décrite dans Cha C. et al, Mol. Plant-Microbe Interact., 1998, 11 , 1 1 19-1129 et McClean KH. et al, Microbiol., 1997, 143, 3703- 371 1. 2) Résultats Lorsque l'opéron attKLM n'est pas induit, par exemple en présence de mannitol comme source de carbone, A tumefaciens C58 et son mutant Cl 01 accumulent la même quantité d'oxo-C8HSL dans leur milieu de croissance (figure 6A). Dans les mêmes conditions, l'expression des fusions transcriptionnelles attJr.lacZ et attKrlacZ est à peine affectée par l'addition de C6HSL et oxo-C8HSL et ne varie pas en fonction du stade de croissance (figures 6B et 6C). Ces résultats indiquent qu'en l'absence d'inducteur de attKLM, l'opéron attKLM n'affecte pas le taux de NAHL chez A tumefaciens. En revanche, lorsque A tumefaciens croît en milieu AB-GBL, il n'accumule pas l'oxo-C8HSL dans le milieu de culture et devient capable d'inactiver les signaux C6HSL et oxo-C8HSL endogènes et exogènes étant donné que l'expression de la lactonase AttM est induite (figures 7A et 7B). Le large spectre de NAHL qui peut-être clivé par la lactonase indique que dans des conditions dans lesquelles l'opéron attKLM est induit, A tumefaciens est capable d'interrompre n'importe quel signal NAHL ; il devient donc une bactérie dégradant efficacement les NAHL. L'inactivation du signal NAHL est aussi observée lorsque A tumefaciens est induit par GHB et SAA, alors que SA n'a pas d'effet (figure 7C). Dans des expériences similaires (figures 7D à 7F), le mutant Cl 01 est insensible à l'addition d'inducteurs, confirmant le lien génétique entre la dispari- tion des NAHL dans le milieu de culture de A tumefaciens C58 et l'expression de la voie de dégradation de GBL.- growth in GHB medium S. SSA, SA (FIG. 4B) The mutant Cl 01 is also affected in the assimilation of GHB and SSA, while no difference is observed between C58 and Cl 01 during their growth in AB medium - HER. 2) GBL. GHB and SSA stimulate the transcription of attKLM The effect of GBL, GHB and SSA on the transcription of the operon attKLM was analyzed by measuring the β-galactosidase activity in A tumefaciens C58 transformed by electroporation, either by the plasmid pMIR122 carrying the transcriptional fusion attK :: lacZ, or by the plasmid pMIR121 carrying the transcriptional fusion attJr. lacZ, used in comparison. Β-galactosidase activity is measured using o-nitrophenyl β D galactopyranoside as substrate and expressed in Miller units (Sambrook J. et al, Molecular cloning: a laboratory manual 1989, 2 nd Ed. Vol 3). Four independent cultures are produced for each experimental condition. In the induction experiments, the cells containing the transcriptional fusions are cultured in AB-mannitol medium, then 360 μl of these cells are mixed with 40 μl of inducer solution to be tested and incubated for 2 hours at 24 ° C. until 'that the measurement of β-galactosidase activity is carried out. The addition of GBL to the culture of bacteria greatly increases the expression of the attKr.lacZ fusion whereas an equivalent addition of mannitol has no effect (FIG. 5). The expression of attJr. lacZ is slightly increased by the addition of GBL (Figure 5), indicating that additional cellular factors or post-transcriptional modifications of the AttJ factor, such as conformational changes in the presence of GBL, could participate in the regulation of the attKLM operon . The other lactones, such as GVL and HSL do not induce the expression of the attKLM operon, while the two metabolic intermediates of the assimilation pathway of GBL, GHB and SSA are effective as inducers (FIG. 5). Example 4 Interference between the expression of attKLM and the AHSL signals 1) Quantification of the NAHL The oxo-C8HSL produced by A tumefaciens are extracted with ethyl acetate from a sample of 8 ml of supernatant of culture of Agrobacterium, and concentrated 100 times before quantification. The NAHL disappearance tests are carried out in E. coli after addition to the medium of C6HSL at 25 μM as described by Carlier et al. Appl. Approx. Microbiol., 2003, 69, 4989-4993, and in A tumefaciens after addition of C6HSL at 25 μM and oxo-C8HSL at 10 μM. In this experiment, the cultures of A tumefaciens in stationary phase are centrifuged and the pellet is resuspended at a cell density of 5.10 CFU / ml in fresh AB medium supplemented with mannitol, GBL, GHB, SSA or SA as a source of carbon. After 15 hours of incubation with shaking, the induced cells are washed with 0.8% NaCl and inoculated at 10 9 CFU / ml in fresh AB medium, supplemented with mannitol (0.2 g / l) and NH 4 C1 ( 0.1 g / 1) and with either C6HSL (25 μM) or oxo-C8HSL (10 μM). The amount of residual NAHL in the culture medium is tested by thin layer reverse liquid chromatography (TLC; KC18 plates, Whatman ® ); the samples are separated in a methanokeau solvent system (60:40), in comparison with a range of appropriate reference products, of known concentration, as described in Cha C. et al, Mol. Plant-Microbe Interact., 1998, 11, 1 1 19-1129 and McClean KH. et al, Microbiol., 1997, 143, 3703-371 1. 2) Results When the attKLM operon is not induced, for example in the presence of mannitol as carbon source, A tumefaciens C58 and its mutant Cl 01 accumulate the same amount of oxo-C8HSL in their growth medium (Figure 6A). Under the same conditions, the expression of the attJr.lacZ and attKrlacZ transcriptional fusions is hardly affected by the addition of C6HSL and oxo-C8HSL and does not vary according to the stage of growth (FIGS. 6B and 6C). These results indicate that in the absence of an attKLM inducer, the attKLM operon does not affect the level of NAHL in A tumefaciens. On the other hand, when A tumefaciens grows in AB-GBL medium, it does not accumulate oxo-C8HSL in the culture medium and becomes capable of inactivating the endogenous and exogenous C6HSL and oxo-C8HSL signals since the expression AttM lactonase is induced (Figures 7A and 7B). The broad spectrum of NAHL which may be cleaved by lactonase indicates that under conditions in which the attKLM operon is induced, A tumefaciens is capable of interrupting any NAHL signal; it therefore becomes a bacterium effectively degrading NAHL. Inactivation of the NAHL signal is also observed when A tumefaciens is induced by GHB and SAA, whereas SA has no effect (FIG. 7C). In similar experiments (FIGS. 7D to 7F), the mutant Cl 01 is insensitive to the addition of inducers, confirming the genetic link between the disappearance tion of NAHL in the culture medium of A tumefaciens C58 and the expression of the GBL degradation pathway.
Exemple 5 : Les inducteurs ά attKLM stimulent la capacité d'une flore complexe à in activer les NAHL Des échantillons de la microflore télurique sont enrichis de la manière suivante : les suspensions bactériennes obtenues à partir de sol tempéré (Gif- sur- Yvette, France) sont inoculées à raison de 103 UFC/ml (densité finale) dans un milieu AB supplémenté avec des extraits de levure (0,2g/l), de l'actidione (100mg/l) et GBL, GHB, SSA, SA ou du mannitol comme source de carbone. Après 3 jours de phase d'enrichissement à 25°C, les bactéries sont lavées avec une solution de NaCl (0,8%) et leur capacité à inactiver les NAHL est testée dans un tampon KH2PO4/K2HPO4 (15mM, pH 6,5) supplémenté avec C6HSL (25 μM) et des extraits de levure (0,2g/l), en suivant le protocole tel que décrit à l'exemple 4. L'interférence entre la voie d'assimilation de GBL et l'inactivation des NAHL est testée dans une micro flore complexe (consortium bactérien). Les populations du sol qui sont activées par les inducteurs de attKLM interrompent le signal C6HSL plus rapidement que les populations activées par de l'acide succinique (figure 8) ou du mannitol. En outre, l'analyse morphologique de la population testée a permis de vérifier que l'étape de culture de l'échantillon de bactéries téluriques en présence de GHB, GBL et SSA n'enrichissait pas la population en A tumefaciens Ces résultats indiquent que les inducteurs à' attKLM sont donc capables de stimuler la capacité d'une microflore complexe à inactiver les NAHL. Exemple 6 : Identification d'un nouvel inducteur de la voie de dégradation de la GBL chez A. tumefaciens, le GABA ou acide γ-aminobutyrique. 1) Identification du GABA comme inducteur de la fusion attKrlacZ chez A tumefaciens C58 La capacité à induire l'expression de l'opéron attKLM chez A tumefaciens, a été testée pour des composés autres que GBL, GHB et SSA, à l'aide de la fusion transcriptionnelle att r.lacZ, comme décrit à l'exemple 3.2. Parmi les composés, testés, seul l'acide γ-aminobutyrique (GABA) induit l'expression de l'opéron attKLM à des niveaux équivalents à ceux observés avec l'acide succinique semialdéhyde (figure 9). Les autres composés sont inactifs, à l'exception de l'acide α- aminobutyrique ou 2-aminobutyriqυe qui possède une faible activité inductrice. Ces résultats indiquent que la présence d'un groupement OH, NH2 ou =O (R3 en référence à la formule I), au niveau du carbone en position gamma de l'acide butyrique (C4 en référence à la formule I), est important pour l'activité inductrice. Toutefois, la présence d'un second groupement, au niveau d'un autre carbone (en position α ou β ; C ou C , en référence à la formule I) semble abolir cet effet. En revanche, l'opéron attKLM n'est pas impliqué dans l'assimilation du GABA par A tumefaciens C58, car aucune différence n'est observée entre la souche sauvage C58 et le mutant Cl 01 de génotype (attJKLM), lors de leur croissance sur GABA comme seule source d'azote.Example 5: The inducers ά attKLM stimulate the capacity of a complex flora to inactivate NAHL Samples of the teluric microflora are enriched as follows: the bacterial suspensions obtained from temperate soil (Gif- sur- Yvette, France ) are inoculated at the rate of 10 3 CFU / ml (final density) in an AB medium supplemented with yeast extracts (0.2 g / l), actidione (100 mg / l) and GBL, GHB, SSA, SA or mannitol as a carbon source. After 3 days of enrichment phase at 25 ° C, the bacteria are washed with NaCl solution (0.8%) and their capacity to inactivate NAHL is tested in a KH 2 PO 4 / K 2 HPO 4 buffer ( 15 mM, pH 6.5) supplemented with C6HSL (25 μM) and yeast extracts (0.2 g / l), following the protocol as described in Example 4. The interference between the assimilation pathway GBL and NAHL inactivation is tested in a complex micro flora (bacterial consortium). Soil populations that are activated by attKLM inducers interrupt the C6HSL signal faster than populations activated by succinic acid (Figure 8) or mannitol. In addition, the morphological analysis of the tested population made it possible to verify that the stage of culture of the sample of teluric bacteria in the presence of GHB, GBL and SSA did not enrich the population with A tumefaciens. These results indicate that the attKLM inducers are therefore capable of stimulating the ability of a complex microflora to inactivate NAHL. Example 6: Identification of a new inducer of the GBL degradation pathway in A. tumefaciens, GABA or γ-aminobutyric acid. 1) Identification of GABA as inducer of attKrlacZ fusion in A tumefaciens C58 The ability to induce the expression of the attKLM operon in A tumefaciens, was tested for compounds other than GBL, GHB and SSA, using the transcriptional att r.lacZ fusion, as described in Example 3.2. Among the compounds tested, only γ-aminobutyric acid (GABA) induces the expression of the attKLM operon at levels equivalent to those observed with succinic acid. semialdehyde (Figure 9). The other compounds are inactive, with the exception of α-aminobutyric acid or 2-aminobutyriqυe which has a weak inductive activity. These results indicate that the presence of an OH, NH 2 or = O group (R 3 with reference to formula I), at the level of the carbon in gamma position of butyric acid (C 4 with reference to formula I) , is important for inducing activity. However, the presence of a second group, at the level of another carbon (in position α or β; C or C, with reference to formula I) seems to abolish this effect. On the other hand, the attKLM operon is not involved in the assimilation of GABA by A tumefaciens C58, because no difference is observed between the wild strain C58 and the mutant Cl 01 of genotype (attJKLM), during their growth. on GABA as the only source of nitrogen.
2) L'induction par le GABA stimule la capacité de dégradation du signal NAHL par A tumefaciens C58. La dégradation du signa] NAHL, chez A. tumefaciens induit par le2) Induction by GABA stimulates the degradation capacity of the NAHL signal by A tumefaciens C58. The degradation of the sign NAHL, in A. tumefaciens induced by
GABA, a été testée comme décrit à l'exemple 4. L'induction de l'opéron attKLM par le GABA est corrélée à la stimulation de la dégradation de la C6-HSL par A tumefaciens C58, en présence de GABA (Figure 10). L'induction par le GABA limite l'accumulation des NAHL naturellement synthétisées par A tumefaciens C58. A tumefaciens C58 produit naturellement une NAHL, la 3-oxo-C8-HSL. L'induction de l'opéron attKLM par le GABA est corrélée à la baisse de la concentration en 3-oxo-C8-HSL dans le milieu de culture d'A tumefaciens C58 (Figure 1 1). Le GABA est un inducteur de l'opéron attKLM qui code pour l'assimilation de la GBL par A tumefaciens C58 et l'inactivation du signal NAHL grâce à la lactonase AttM. En présence de GABA, comme en présence de GBL, GHB et SSA, A tumefaciens C58 est incapable d'accumuler de la 3-oxo-C8-HSL dans son milieu de culture, et devient capable de dégrader des NAHL exogènes comme la C6- HSL. Le GABA est donc une molécule potentiellement intéressante pour inactiver le signal de quorums ensing via la voie de dégradation de la GBL. Ainsi que cela ressort de ce qui précède, l'invention ne se limite nullement à ceux de ses modes de mise en œuvre, de réalisation et d'application qui viennent d'être décrits de façon plus explicite ; elle en embrasse au contraire toutes les variantes qui peuvent venir à l'esprit du technicien en la matière, sans s'écarter du cadre, ni de la portée, de la présente invention. GABA, was tested as described in Example 4. The induction of the attKLM operon by GABA is correlated with the stimulation of the degradation of C6-HSL by A tumefaciens C58, in the presence of GABA (FIG. 10) . Induction by GABA limits the accumulation of NAHLs naturally synthesized by A tumefaciens C58. A tumefaciens C58 naturally produces a NAHL, 3-oxo-C8-HSL. The induction of the attKLM operon by GABA is correlated with the drop in the concentration of 3-oxo-C8-HSL in the culture medium of A tumefaciens C58 (Figure 11). GABA is an inducer of the attKLM operon which codes for the assimilation of GBL by A tumefaciens C58 and the inactivation of the NAHL signal thanks to the lactonase AttM. In the presence of GABA, as in the presence of GBL, GHB and SSA, A tumefaciens C58 is unable to accumulate 3-oxo-C8-HSL in its culture medium, and becomes capable of degrading exogenous NAHLs such as C6- HSL. GABA is therefore a potentially interesting molecule for inactivating the quorums ensing signal via the GBL degradation pathway. As is apparent from the above, the invention is in no way limited to those of its modes of implementation, embodiment and application which have just been described more explicitly; on the contrary, it embraces all the variants which may come to the mind of the technician in the matter, without departing from the framework, or the scope, of the present invention.

Claims

REVENDICATIONS 1 °) Utilisation d'un inducteur de la voie de dégradation de la γ- butyrolactone pour augmenter la dégradation enzymatique de la N-acyl homosérine lactone chez les bactéries pathogènes à Gram négatif sensibles au signal N-acyl homosérine lactone, à l'exclusion de l'acide butyrique et de l'acide α-hydroxy-β- méthylbutyrique. 2°) Utilisation selon la revendication 1 , caractérisée en ce que ledit inducteur est choisi parmi les composés répondant à la formule (I) :CLAIMS 1 °) Use of an inducer of the γ-butyrolactone degradation pathway to increase the enzymatic degradation of N-acyl homoserine lactone in Gram-negative pathogenic bacteria sensitive to the N-acyl homoserine lactone signal, to the exclusion of butyric acid and of α-hydroxy-β- methylbutyric acid. 2 °) Use according to claim 1, characterized in that said inducer is chosen from the compounds corresponding to formula (I):
Figure imgf000024_0001
Figure imgf000024_0001
dans laquelle Ri, R2 et R3 représentent chacun un hydrogène, un groupement hydroxyle, aminé ou =O, ou bien un groupement alkyle, acyle ou hydroxyalkyle en C1-C4 ; étant entendu que lorsque R3 est un groupement hydroxyle, il peut réagir avec le groupement hydroxyle porté par le carbone en position 1 (C)), pour former un ester cyclique (lactone), ainsi que leurs sels dérivés. 3°) Utilisation selon la revendication 2, caractérisée en ce que R3 représente, un groupement hydroxyle, aminé ou =O, ou bien un groupement acyle ou hydroxyalkyle en Cj-C , et R2 est différent d'une a iné primaire. 4°) Utilisation selon la revendication 3, caractérisée en ce que ledit inducteur est choisi parmi : la γ-butyrolactone, le γ-hydroxybutyrate, le succinate semialdéhyde et l'acide γ-aminobutyrique. 5°) Utilisation d'un inducteur de la voie de dégradation de la γ- butyrolactone selon l'une quelconque des revendications 1 à 4, pour la préparation d'un médicament pour la prévention et le traitement d'infections par des bactéries pathogènes à Gram négatif sensibles au signal N-acyl homosérine lactone, chez l'homme et les animaux. 6°) Utilisation selon la revendication 4, caractérisée en ce que ledit médicament comprend du succinate semialdéhyde ou de l'acide γ-aminobutyrique. 7°) Utilisation, selon l'une quelconque des revendications 1 à 4, caractérisée en ce que ledit inducteur est destiné à un usage phytosanitaire, pour la prévention et/ou le traitement d'infections par des microorganismes pathogènes producteurs de N-acyl homosérine lactone, chez les plantes. 8°) Utilisation, selon l'une quelconque des revendications 1 à 4, caractérisée en ce que ledit inducteur est destiné à un usage agroalimentaire, pour la conservation des produits frais, notamment des fruits et de légumes. 9°) Utilisation d'un inducteur de la voie de dégradation de la γ- butyrolactone, selon l'une quelconque des revendications 1 à 4, pour désinfecter l'environnement ou le matériel. 10°) Inducteur de la voie de dégradation de la γ-butyrolactone tel que défini à l'une quelconque des revendications 1 à 4 comme médicament. 1 1 °) Procédé de sélection/criblage de composés antibactériens, caractérisé en ce qu'il comprend au moins les étapes suivantes : a) la mise en contact d'un organisme ou de cellules dérivées dudit organisme avec un composé à tester, b) la mesure par tout moyen approprié de l'induction de la voie de dégradation de la γ-butyrolactone chez ledit organisme ou lesdites cellules, et c) la sélection des composés capables d'induire la voie de dégradation de la γ-butyrolactone chez ledit organisme ou lesdites cellules. 12°) Cellules eucaryotes ou procaryotes modifiées par les gènes de la voie de synthèse d'un inducteur selon l'une quelconque des revendications 1 à 4. 13°) Mammifère non-humain transgénique, caractérisé en ce que tout ou partie de ses cellules sont modifiées par les gènes de la voie de synthèse d'un inducteur selon l'une quelconque des revendications 1 à 4. 14°) Plante transgénique, caractérisée en ce que tout ou partie de ses cellules sont modifiées par les gènes de la voie de synthèse d'un inducteur selon l'une quelconque des revendications 1 à 4. in which R 1, R 2 and R 3 each represent a hydrogen, a hydroxyl, amino or = O group, or else a C 1 -C 4 alkyl, acyl or hydroxyalkyl group; it being understood that when R 3 is a hydroxyl group, it can react with the hydroxyl group carried by the carbon in position 1 (C)), to form a cyclic ester (lactone), as well as their derived salts. 3 °) Use according to claim 2, characterized in that R 3 represents a hydroxyl group, amine or = O, or an acyl or hydroxyalkyl group Cj-C, and R 2 is different from a primary ine. 4 °) Use according to claim 3, characterized in that said inducer is chosen from: γ-butyrolactone, γ-hydroxybutyrate, semialdehyde succinate and γ-aminobutyric acid. 5 °) Use of an inducer of the γ-butyrolactone degradation pathway according to any one of claims 1 to 4, for the preparation of a medicament for the prevention and treatment of infections by pathogenic bacteria to Gram negative signal-sensitive N-acyl homoserine lactone, in humans and animals. 6 °) Use according to claim 4, characterized in that said medicament comprises semialdehyde succinate or γ-aminobutyric acid. 7 °) Use according to any one of claims 1 to 4, characterized in that said inducer is intended for phytosanitary use, for the prevention and / or treatment of infections by pathogenic microorganisms producing N-acyl homoserine lactone, in plants. 8 °) Use according to any one of claims 1 to 4, characterized in that said inductor is intended for agrifood use, for the preservation of fresh products, in particular fruits and vegetables. 9 °) Use of an inducer of the γ-butyrolactone degradation pathway, according to any one of claims 1 to 4, for disinfecting the environment or the material. 10 °) inducer of the degradation pathway of γ-butyrolactone as defined in any one of claims 1 to 4 as a medicament. 1 1 °) Method of selection / screening of antibacterial compounds, characterized in that it comprises at least the following steps: a) bringing an organism or cells derived from said organism into contact with a compound to be tested, b) measuring by any appropriate means the induction of the degradation pathway of γ-butyrolactone in said organism or said cells, and c) the selection of the compounds capable of inducing the degradation pathway of γ-butyrolactone in said organism or said cells. 12 °) Eukaryotic or prokaryotic cells modified by the genes of the synthesis pathway of an inducer according to any one of Claims 1 to 4. 13 °) Transgenic non-human mammal, characterized in that all or part of its cells are modified by the genes of the synthetic pathway of an inducer according to any one of claims 1 to 4. 14 °) transgenic plant, characterized in that all or part of its cells are modified by the genes of the pathway synthesis of an inductor according to any one of claims 1 to 4.
PCT/FR2004/003116 2003-12-04 2004-12-03 Use of inductors of the degradation pathway of gamma-butyrolactone for inactivating the homoserine lactone n-acyl signal of gram-negative pathogenic bacteria WO2005056002A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0314231A FR2863168A1 (en) 2003-12-04 2003-12-04 Antibacterial agents comprising gamma--butyrolactone degradation pathway inducers, e.g. succinate semialdehyde, useful in human or veterinary medicine, plant or foodstuff protection or disinfection
FR0314231 2003-12-04

Publications (2)

Publication Number Publication Date
WO2005056002A2 true WO2005056002A2 (en) 2005-06-23
WO2005056002A3 WO2005056002A3 (en) 2006-02-23

Family

ID=34586297

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2004/003116 WO2005056002A2 (en) 2003-12-04 2004-12-03 Use of inductors of the degradation pathway of gamma-butyrolactone for inactivating the homoserine lactone n-acyl signal of gram-negative pathogenic bacteria

Country Status (2)

Country Link
FR (1) FR2863168A1 (en)
WO (1) WO2005056002A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007124949A1 (en) 2006-05-01 2007-11-08 Universiteit Gent Hydroxybutyrate and poly-hydroxybutyrate as components of animal feed or feed additives
WO2008090479A2 (en) * 2007-01-19 2008-07-31 Centre National De La Recherche Scientifique Chemicals promoting the growth of n-acylhomoserine lactone-degrading bacteria.

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111705028A (en) 2012-06-04 2020-09-25 基因组股份公司 Microorganisms and methods for making 4-hydroxybutyrate, 1, 4-butanediol, and related compounds
CN110563996B (en) * 2019-09-10 2021-12-21 大连民族大学 Gram-negative bacterium quorum sensing quenching polymer

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3086907A (en) * 1958-03-06 1963-04-23 Gen Aniline & Film Corp Method for controlling soil nematodes
US3629451A (en) * 1969-03-03 1971-12-21 Stanley Drug Products Inc Method of treating bacterial infections
US3895116A (en) * 1971-11-29 1975-07-15 Eastman Kodak Co Mixtures of volatile fatty acids having anti-fungal and anti-bacterial activity
US4179522A (en) * 1975-11-27 1979-12-18 Bp Chemicals Limited Certain complex salts of mono carboxylic acids used as preservatives
US4550026A (en) * 1983-02-15 1985-10-29 Yosuke Akiba Method for preserving food using a preservative gas atmosphere
WO1995015684A1 (en) * 1993-12-12 1995-06-15 Agrogene, Ltd. A novel method to protect plants from fungal infection
US5462714A (en) * 1992-09-22 1995-10-31 Arda Technologies Antimicrobial composition and methods of use
CA2144021A1 (en) * 1994-05-10 1995-11-11 V. Gerold Luss Non-toxic, non-corrosive microbicidal composition
WO1996011572A1 (en) * 1994-10-14 1996-04-25 Sven Moberg Antimicrobial composition
WO1996029392A1 (en) * 1995-03-23 1996-09-26 Unisearch Limited Methods for microbial regulation
WO1997000676A1 (en) * 1995-06-21 1997-01-09 Oy Extracta Ltd. Antimicrobial and anti-inflammatory compounds
WO1997027851A1 (en) * 1996-02-01 1997-08-07 The Johns-Hopkins University L-homoserine and l-homoserine lactone as bacteriostatic agents for m. tuberculosis and m. bovis
WO1999059574A1 (en) * 1998-05-21 1999-11-25 Magainin Pharmaceuticals, Inc. A method for stimulation of defensin production by exposure to isoleucin
DE19826499A1 (en) * 1998-06-13 1999-12-16 Beiersdorf Ag Use of lactone, thiolactone and/or dithiolactone derivatives
WO2001057174A1 (en) * 2000-02-01 2001-08-09 Reckitt Benckiser Inc. Hard surface cleaning composition
US20020183387A1 (en) * 2001-06-04 2002-12-05 Bogart Mark H. Methods for the treatment of nail fungus and other microbial and mycotic conditions and compositions useful therefor
WO2003018049A2 (en) * 2001-08-23 2003-03-06 Westgate Biological Limited Use of milk serum apoproteins in the prophylaxis or treatment of microbial or viral infection
US20030060457A1 (en) * 1998-07-31 2003-03-27 Schaffer Priscilla A. Cellular proteins as targets for the treatment of pathogens resistant to drugs that target pathogen-encoded proteins

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5758651A (en) * 1980-09-25 1982-04-08 Kayaku:Kk Preparation of diamino acid derivative
JPH0255794A (en) * 1988-08-22 1990-02-26 Asahi Denka Kogyo Kk Antibacterial lubricating agent composition
RU2048807C1 (en) * 1993-10-10 1995-11-27 Научно-исследовательская фирма "Ультрасан" Antibacterial and antiinflammatory preparation
AUPM666694A0 (en) * 1994-07-06 1994-07-28 Unisearch Limited Natural antifouling compositions
JP4536856B2 (en) * 2000-01-25 2010-09-01 カゴメ株式会社 Plant plague control agent and control method

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3086907A (en) * 1958-03-06 1963-04-23 Gen Aniline & Film Corp Method for controlling soil nematodes
US3629451A (en) * 1969-03-03 1971-12-21 Stanley Drug Products Inc Method of treating bacterial infections
US3895116A (en) * 1971-11-29 1975-07-15 Eastman Kodak Co Mixtures of volatile fatty acids having anti-fungal and anti-bacterial activity
US4179522A (en) * 1975-11-27 1979-12-18 Bp Chemicals Limited Certain complex salts of mono carboxylic acids used as preservatives
US4550026A (en) * 1983-02-15 1985-10-29 Yosuke Akiba Method for preserving food using a preservative gas atmosphere
US5462714A (en) * 1992-09-22 1995-10-31 Arda Technologies Antimicrobial composition and methods of use
WO1995015684A1 (en) * 1993-12-12 1995-06-15 Agrogene, Ltd. A novel method to protect plants from fungal infection
CA2144021A1 (en) * 1994-05-10 1995-11-11 V. Gerold Luss Non-toxic, non-corrosive microbicidal composition
WO1996011572A1 (en) * 1994-10-14 1996-04-25 Sven Moberg Antimicrobial composition
WO1996029392A1 (en) * 1995-03-23 1996-09-26 Unisearch Limited Methods for microbial regulation
WO1997000676A1 (en) * 1995-06-21 1997-01-09 Oy Extracta Ltd. Antimicrobial and anti-inflammatory compounds
WO1997027851A1 (en) * 1996-02-01 1997-08-07 The Johns-Hopkins University L-homoserine and l-homoserine lactone as bacteriostatic agents for m. tuberculosis and m. bovis
WO1999059574A1 (en) * 1998-05-21 1999-11-25 Magainin Pharmaceuticals, Inc. A method for stimulation of defensin production by exposure to isoleucin
DE19826499A1 (en) * 1998-06-13 1999-12-16 Beiersdorf Ag Use of lactone, thiolactone and/or dithiolactone derivatives
US20030060457A1 (en) * 1998-07-31 2003-03-27 Schaffer Priscilla A. Cellular proteins as targets for the treatment of pathogens resistant to drugs that target pathogen-encoded proteins
WO2001057174A1 (en) * 2000-02-01 2001-08-09 Reckitt Benckiser Inc. Hard surface cleaning composition
US20020183387A1 (en) * 2001-06-04 2002-12-05 Bogart Mark H. Methods for the treatment of nail fungus and other microbial and mycotic conditions and compositions useful therefor
WO2003018049A2 (en) * 2001-08-23 2003-03-06 Westgate Biological Limited Use of milk serum apoproteins in the prophylaxis or treatment of microbial or viral infection

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CARLIER A ET AL: "The Ti plasmid of Agrobacterium tumefaciens harbors an attM-paralogous gene, aiiB, also encoding N-Acyl homoserine lactonase activity." APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 69, no. 8, août 2003 (2003-08), pages 4989-4993, XP002288910 ISSN: 0099-2240 *
DATABASE WPI Section Ch, Week 199014 Derwent Publications Ltd., London, GB; Class D22, AN 1990-104332 XP002295418 & JP 02 055794 A (ASAHI CHEM IND CO LTD) 26 février 1990 (1990-02-26) *
DATABASE WPI Section Ch, Week 199630 Derwent Publications Ltd., London, GB; Class B05, AN 1996-298701 XP002288911 & RU 2 048 807 C1 (ULTRASAN RES FIRM) 27 novembre 1995 (1995-11-27) *
DATABASE WPI Section Ch, Week 200173 Derwent Publications Ltd., London, GB; Class C05, AN 2001-629504 XP002288912 & JP 2001 206811 A (KAGOME KK) 31 juillet 2001 (2001-07-31) *
PATENT ABSTRACTS OF JAPAN vol. 006, no. 135 (C-115), 22 juillet 1982 (1982-07-22) & JP 57 058651 A (KAYAKU:KK), 8 avril 1982 (1982-04-08) *
UROZ STÉPHANE ET AL: "Novel bacteria degrading N-acylhomoserine lactones and their use as quenchers of quorum-sensing-regulated functions of plant-pathogenic bacteria." MICROBIOLOGY (READING, ENGLAND) AUG 2003, vol. 149, no. Pt 8, août 2003 (2003-08), pages 1981-1989, XP002288909 ISSN: 1350-0872 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007124949A1 (en) 2006-05-01 2007-11-08 Universiteit Gent Hydroxybutyrate and poly-hydroxybutyrate as components of animal feed or feed additives
AU2007245806B2 (en) * 2006-05-01 2012-11-15 Universiteit Gent Hydroxybutyrate and poly-hydroxybutyrate as components of animal feed or feed additives
US8603518B2 (en) 2006-05-01 2013-12-10 Universiteit Gent Hydroxybutyrate and poly-hydroxybutyrate as components of animal feed or feed additives
WO2008090479A2 (en) * 2007-01-19 2008-07-31 Centre National De La Recherche Scientifique Chemicals promoting the growth of n-acylhomoserine lactone-degrading bacteria.
WO2008090479A3 (en) * 2007-01-19 2009-04-30 Centre Nat Rech Scient Chemicals promoting the growth of n-acylhomoserine lactone-degrading bacteria.
US8354265B2 (en) 2007-01-19 2013-01-15 Centre National De La Recherche Scientifique Chemicals promoting the growth of N-acylhomoserine lactone-degrading bacteria

Also Published As

Publication number Publication date
FR2863168A1 (en) 2005-06-10
WO2005056002A3 (en) 2006-02-23

Similar Documents

Publication Publication Date Title
Patten et al. Activity, distribution and function of indole-3-acetic acid biosynthetic pathways in bacteria
Bölker et al. Ustilago maydis secondary metabolism—from genomics to biochemistry
Liu et al. Quorum sensing asaI mutants affect spoilage phenotypes, motility, and biofilm formation in a marine fish isolate of Aeromonas salmonicida
Saikia et al. Biodegradation of beta-cyfluthrin by Pseudomonas stutzeri strain S1
DK2326713T3 (en) A process for the preparation of an additive for the enzymatic degradation of the mycotoxins, as well as additive and the use thereof
Twigg et al. Interference with the germination and growth of U lva zoospores by quorum‐sensing molecules from U lva‐associated epiphytic bacteria
EP3174395A1 (en) Agricultural methods
Becker et al. A tale of four kingdoms–isoxazolin-5-one-and 3-nitropropanoic acid-derived natural products
JP7049689B2 (en) Pseudomonas putida strain, and its use in the control of bacterial and fungal-induced diseases in plants
EP1154692B1 (en) A method of controlling fungal pathogens, and agents useful for same
Dixit et al. Roles of quorum sensing molecules from Rhizobium etli RT1 in bacterial motility and biofilm formation
AU2017213527A1 (en) Composition comprising nucleic acids of parasitic, pathogenic or weed biological systems for inhibiting and/or controlling the growth of said systems and process for the preparation thereof
WO2005056002A2 (en) Use of inductors of the degradation pathway of gamma-butyrolactone for inactivating the homoserine lactone n-acyl signal of gram-negative pathogenic bacteria
JP2007099626A (en) Surfactin-containing composition for controlling common scab of field crop
EP2313490B9 (en) New streptomyces beta-vulgaris strain, culture filtrate, derived active compounds and use thereof in the treatment of plants
Rabinovitz et al. Amino acid antagonist death in Escherichia coli
FR2546907A1 (en) Riboflavin prepn.
De La Fuente et al. Utilization of trehalose, benzoate, valerate, and seed and root exudates by genotypes of 2, 4-diacetylphloroglucinol producing Pseudomonas fluorescens
WO2016151262A1 (en) Novel method for promoting nodulation in plants
Boland Natural Product Reports
WO2015044585A1 (en) Agricultural uses of a novel bacterium of the genus streptomyces
Takeuchi et al. Glutamate Positively Regulates Chitinase Activity and the Biocontrol Efficacy of Pseudomonas protegens
WO2013129291A1 (en) Aflatoxin production inhibitor and method for producing same, aflatoxin contamination control method, and bacterium capable of producing aflatoxin production inhibitor
Saliga Characterizing the CsaI-CsaR quorum sensing system in Pseudomonas chlororaphis strain PA23 and investigating its role in regulating the production of secondary metabolites
WO2001020030A2 (en) Nucleotide sequences derived from genes coding for trimethylamine n-oxide reductase, uses thereof in particular for detecting bacteria

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase